IOVS Journal of Nutrition
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2005;46:1440-1444.)
© 2005 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.04-0905

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tamura, H.
Right arrow Articles by Yoshimura, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tamura, H.
Right arrow Articles by Yoshimura, N.

Intravitreal Injection of Corticosteroid Attenuates Leukostasis and Vascular Leakage in Experimental Diabetic Retina

Hiroshi Tamura, Kazuaki Miyamoto, Junichi Kiryu, Shinsuke Miyahara, Hideto Katsuta, Fumitaka Hirose, Kunihiro Musashi, and Nagahisa Yoshimura

From the Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, Kyoto, Japan.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. Recently, intravitreal injection of corticosteroids has been in wide use as a treatment for diabetic macular edema, and the outcomes have been favorable. However, the exact mechanism remains unclear. The hypothesis for the current study was that intravitreal corticosteroids may improve diabetic retinal edema by amelioration of blood–retinal barrier (BRB) breakdown, by inhibiting leukocyte stasis (leukostasis).

METHODS. Diabetes was induced in 6-week-old male Long-Evans rats by intraperitoneal injection of streptozotocin (75 mg/kg). Three weeks after induction of diabetes, intravitreal injection of dexamethasone (40 µg/10 µL) was performed. At 2 days after intravitreal injection, accumulated leukocytes were counted in vivo by acridine orange leukocyte fluorography, and BRB breakdown was evaluated by measurement of retinal vascular permeability. The mRNA expression and protein levels of intercellular adhesion molecule (ICAM)-1 in the retina were also studied.

RESULTS. The number of leukocytes accumulated in the retina, once increased in the diabetic group, was decreased by 31.6% (P = 0.0001) after dexamethasone injection. The level of BRB breakdown, also elevated in the diabetic group, was suppressed by 61.1% (P = 0.0046) after dexamethasone injection. The level of ICAM-1 mRNA expression and its protein, upregulated in the diabetic group, were downregulated by dexamethasone treatment by 70.0% (P < 0.0001) and 56.4% (P = 0.0003).

CONCLUSIONS. Intravitreal injection of corticosteroids improves diabetic retinal edema through inhibiting leukocyte recruitment in the diabetic retina.


Retinopathy is a major complication of diabetes mellitus (DM) and one of the leading causes of acquired blindness. Diabetic macular edema is most often responsible for reduced visual acuity in these patients. In recent years, intravitreal injection of corticosteroids such as triamcinolone acetonide has been increasingly used as a treatment for diabetic macular edema, with favorable outcomes.1 2 3 This type of retinal edema is considered to occur after the breakdown of the blood–retinal barrier (BRB), which is associated with retinal vascular leakage. It is generally believed that intravitreal corticosteroid can ameliorate the BRB breakdown and then improve the macular edema. However, the exact mechanism remains unclear.

Leukocyte stasis (leukostasis) has been implicated in the retinal microcirculation of early diabetic retinopathy.4 And leukocytes have been mentioned as a trigger of two major complications of diabetes: retinal vascular leakage and nonperfusion.5 More specifically, leukostasis produces free radicals from oxygen molecules and inflammatory cytokines, which increase vascular permeability, or BRB breakdown: Leukostasis leads to BRB breakdown. Leukocytes appear to have a central role in the development of diabetic retinopathy.

In the present study, we tested the hypothesis that diabetic retinal edema may be improved by intravitreal injection of corticosteroid through leukocyte–endothelial cell interactions. We quantitatively determined the inhibitory effects of intravitreal corticosteroid on leukocyte recruitment in the retina and evaluated BRB breakdown in experimental diabetic rats. Leukocyte recruitment in the retina was evaluated by acridine orange (AO) leukocyte fluorography,6 7 a technique that allowed us to visualize leukocyte behavior in the retinal microcirculation with minimal invasion. We also examined the effect of intravitreally injected corticosteroid on intercellular adhesion molecule (ICAM)-1 gene expression and its protein levels.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Animal Model
Animals (n = 72) were handled in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. DM was induced in 6-week-old male pigmented Long-Evans rats by intraperitoneal injection of streptozotocin (STZ, 75 mg/kg). The plasma glucose level in each rat was confirmed to be >250 mg/dL 48 hours after injection. Rats injected with an equal volume of saline alone served as nondiabetic (non-DM) control subjects. Three weeks after induction of diabetes, intravitreal injection of dexamethasone was performed. All rats were maintained with free access to water and food in an air-conditioned room on a 12-hour light–dark cycle before the start of the experiments. Plasma glucose levels were measured with a self-monitoring blood glucose system (Dexter Z II; Bayer Healthcare LLC, Tarrytown, NY).

Intravitreal Injection of Dexamethasone
Animals were anesthetized with a 1:1 mixture of xylazine hydrochloride (4 mg/kg) and ketamine hydrochloride (10 mg/kg), and the pupils were dilated with 0.5% tropicamide and 2.5% phenylephrine hydrochloride. For additional topical anesthesia, 0.4% procaine hydrochloride (Santen Co., Osaka, Japan) was used. Then, 0.5% of levofloxacin ophthalmic solution (Santen Co.) was applied to the ocular surface, to prevent infection. A single dose of 40 µg dexamethasone in a volume of 10 µL (4 mg/mL; Banyu, Tokyo, Japan) was injected into the vitreous of the right eye with a microinjector (Hamilton Co., Reno, NV) under a dissecting microscope (n = 6). A new 30-gauge needle was used to make a punch incision 1 mm posterior to the temporal limbus, and the microinjector needle was then inserted through the incision, approximately 1.5 mm deep, angled toward the optic nerve. Eyes with injection-damaged lenses or retinas were excluded from the study. For diabetic control, 10 µL physiological saline was injected into the right eye of other animals (n = 6).

AO Leukocyte Fluorography
At 2 days after the intravitreal injection, leukocyte behavior was evaluated in vivo by AO leukocyte fluorography, which has been described previously.6 7 Six rats were used in each group. In this technique, a scanning laser ophthalmoscope (SLO; Rodenstock Instruments, Munich, Germany), coupled with a computer-assisted image analysis system, yields continuous high-resolution images of the fundus of an animal injected with metachromatic fluorochrome AO (Wako Pure Chemical, Osaka, Japan). AO is a widely used probe in biochemical and cytochemical studies. The obtained images were recorded on S-VHS videotape at a rate of 30 frames/s for further analysis.

Immediately before AO leukocyte fluorography, rats were deeply anesthetized with the method just described. In each rat, a catheter was inserted into the tail vein. Arterial blood pressure was monitored with a blood pressure analyzer (IITC, Woodland Hills, CA). The rat was then placed on a movable platform, and AO (0.1% solution in saline) was injected through the tail vein catheter. The fundus was observed with the SLO in the 40° field. The behavior of leukocytes can be observed within several seconds after AO infusion, because AO has a circulation time of <10 seconds and is so membrane permeable that leukocytes are stained with the dye shortly after infusion. AO was injected for 1 minute at a rate of 1 mL/min, to examine the behavior of leukocytes over a few minutes. At 30 minutes after injection of AO, the fundus was observed again to evaluate leukocyte accumulation in the retinal microcirculation.

Image Analysis
The video recordings were analyzed with an image-analysis system consisting of a computer equipped with a video digitizer (Radius, San Jose, CA). The video image was digitized in real time (30 frames/s) to 640 horizontal and 480 vertical pixels with an intensity resolution of 256 steps. Using this system, we evaluated the number of leukocytes accumulated in the retinal microcirculation.

The number of leukocytes accumulated in the retinal microcirculation was determined at 30 minutes after AO injection, as described previously.6 Briefly, an observation area around the optic disc was determined by drawing a polygon surrounded by the adjacent major retinal vessels. This area was measured in pixels on a computer monitor, and the density of leukocytes was calculated by dividing the number of trapped leukocytes, which were recognized as fluorescent dots, by the area of observation. The density of leukocytes was calculated in eight peripapillary observation areas in the fundus. The average density was used as the number of leukocytes accumulated in retinal microcirculation for each rat.

After the experiment, each rat was killed with an overdose of the anesthetic, and the right eye was enucleated to obtain a calibration factor to convert the values measured on a computer monitor (in pixels) into real values (in micrometers).

Quantification of BRB Breakdown
BRB breakdown was evaluated via measurement of retinal permeability with FITC-conjugated dextran (Sigma-Aldrich, St. Louis, MO), according to a method described elsewhere, with slight modification.8 9 10 Two days after the intravitreal injection of dexamethasone or saline vehicle, one eye of each of six diabetic rats was examined. In rats under deep anesthesia, FITC-conjugated dextran (4.4 kDa, 50 mg/mL in phosphate-buffered saline [PBS]), 50 mg/kg body weight; Sigma-Aldrich) was injected intravenously. Ten minutes after injection, the chest cavity was opened, and a 20-gauge perfusion cannula was introduced into the aorta. A blood sample was collected immediately before perfusion. After achieving drainage from the right atrium, each rat was perfused with PBS (500 mL/kg body weight) to clear the remaining intravascular dextran. The blood sample was centrifuged at 7000 rpm for 20 minutes at 4°C, and the supernatant was diluted at 1:1000. Immediately after perfusion, the retinas were carefully removed, weighed, and homogenized to extract the FITC-dextran in 0.4 mL of water. The extract was processed through a 30,000 molecular weight filter (Ultrafree-MC; Millipore, Bedford, MA) at 7,000 rpm for 90 minutes at 4°C. The fluorescence in each 300-µL sample was measured (excitation, 485 nm; emission, 538 nm) using a spectrofluorometer (Fluor Imager SI; Molecular Dynamics, Sunnyvale, CA) with water as a blank. Corrections were made by subtracting the autofluorescence of retinal tissue from rats without FITC-dextran injection. For normalization, the retinal FITC-dextran amount was divided by the retinal weight and by the concentration of FITC-dextran in the plasma.

Semiquantification of ICAM-1Gene Expression by Reverse Transcription–Polymerase Chain Reaction
For semiquantification of ICAM-1 gene expression after 1 day of dexamethasone injection, six eyes per group were enucleated in the following four groups: nondiabetic control rats, DM rats without intravitreal injection, vehicle-treated rats, and dexamethasone-treated rats. Total RNA was isolated from the retina according to the acid guanidinium thiocyanate-phenol-chloroform extraction method.8 11 Extracted RNA was quantified, and 2 µg was used to prepare cDNA with a cDNA synthesis kit (Omniscript Reverse Transcriptase; Qiagen, Valencia, CA). Polymerase chain reaction (PCR) was performed under the following conditions: denaturation at 94°C for 1 minute, annealing at 62°C for 1 minute, and extension at 72°C for 1 minute. The reaction was performed for 34 cycles for ICAM-1and 29 cycles for ß-actin. The primers were AGCCTCAGGCCTAAGAGGAC (sense) and AGGGGTCCCAGAGAGGTCTA (antisense) for ICAM-1 and GGCATCCTGACCCTGAAGTA (sense) and GCCATCTCTTGCTCGAAGTC (antisense) for ß-actin. After completion, 10 µL of the reactions were analyzed by agarose gel electrophoresis and ethidium bromide staining to determine the levels of transcript relative to the control transcript ß-actin RNA.

Enzyme-Linked Immunosorbent Assay for ICAM-1
The eyes were enucleated after 2 days of dexamethasone injection and an enzyme-linked immunosorbent assay was performed.8 11 The retina was carefully isolated, placed in 150 µL of lysis buffer (20% glycerol, 10 mM KCl, 1 mM MgCl2, 0.1% Triton, 300 mM NaCl, 0.5 mM dithiothreitol [DTT], 0.5 mM phenylmethylsulfonyl fluoride [PMSF], and 20 mM HEPES [pH 7.9]) and homogenized. The lysate was centrifuged at 14,000 rpm for 15 minutes at 4°C, and the ICAM-1 levels in the supernatant were determined with a kit (Quantikine; R&D Systems, Minneapolis, MN) used according to the manufacturer’s protocol. Total protein was determined using the bicinchoninic acid (BCA) kit (Bio-Rad, Hercules, CA) and this level was used to normalize the ICAM-1 protein levels.

Statistical Analysis
All data are expressed as the mean ± SEM. Student’s t-test was used for statistical analysis between the two groups. ANOVA was used to compare three or more conditions, with post hoc comparisons tested using the Fisher protected least-significant difference procedure. Differences were considered statistically significant at P < 0.05.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Physiologic Data
Table 1 shows changes in physiologic variables of each group. There were no significant differences among groups in any of the physiological data except blood glucose levels. The blood glucose level was significantly higher in all other three groups than in the control group. No significant difference was found in blood glucose levels between the untreated DM group or the vehicle-treated group and the dexamethasone-treated group.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Physiological Variables for Each Group

 
Leukocyte Accumulation
Immediately after AO was infused intravenously, leukocytes were selectively stained among circulating blood cells. At 30 minutes after AO infusion, we identified leukocytes that had accumulated in the retina as distinct fluorescent dots with the highest contrast (Fig. 1) . Figure 2 shows the number of leukocytes accumulated in the retina in each group after intravitreal injection. Figure 3 shows time-course changes in the number of leukocytes accumulated in the retina after intravitreal injection of dexamethasone. At 2 days after dexamethasone injection, the number of accumulated leukocytes mostly decreased. Few leukocytes were found in nondiabetic control retinas. However, the number of accumulated leukocytes in the untreated DM rats and in the vehicle-treated DM rats were 1.8- and 2.0-fold as many as in the nondiabetic control rats (both P < 0.0001), respectively. There was no significant difference between these two DM groups. Accumulated leukocyte count was significantly suppressed in the dexamethasone-treated group by 31.6% (P = 0.0001), compared with the vehicle-treated group.



View larger version (121K):
[in this window]
[in a new window]
 
FIGURE 1. Fluorescent dots are accumulated leukocytes after AO injection. (A) A small number of leukocytes were found in the retina of nondiabetic control rats. (B) A large number accumulated in the retina of the untreated DM rats. (C) Almost the same number accumulated in the retina of the vehicle-treated DM rats as were seen in the untreated DM rats. (D) A significant reduction in the number of accumulated leukocytes was seen in the retina of the dexamethasone-treated DM rats.

 


View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 2. The number of leukocytes accumulating in the retina. Data are the mean ± SEM (n = 6 in each group). *P < 0.0001 compared with control rats. {dagger}P < 0.001 compared with vehicle-treated rats.

 


View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 3. Time-course of the number of leukocytes accumulated in the retina of the DM rats after dexamethasone injection. Data are the mean ± SEM (n = 6 at each time). *P < 0.05 compared with DM rats before dexamethasone injection.

 
BRB Breakdown
Figure 4 shows retinal vascular permeability in each group at 2 days after intravitreal injection. The levels of BRB breakdown were expressed as ratios to the mean level in nondiabetic control rats. Retinal vascular permeability in the untreated DM group and the vehicle-treated group was 4.5-and 5.2-fold as high as in the nondiabetic control group (P = 0.0049 and P = 0.0007), respectively, and there was no significant difference between these two groups. Dexamethasone treatment compared with the vehicle treatment significantly suppressed vascular permeability (P = 0.0046).



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 4. Retinal leakage of FITC-conjugated dextran. The levels of retinal vascular leakage are expressed as ratios to the average level in control rats. Data are the mean ± SEM (n = 6 in each group). *P < 0.005 compared with control rats. {dagger}P < 0.005 compared with vehicle-treated rats.

 
ICAM-1 Gene Expression and Protein Levels
The levels of gene expression are shown as ratios to the mean levels in nondiabetic control rats (Fig. 5) . At 1 day after intravitreal injection, ICAM-1 mRNA expression was upregulated in the retina of the untreated DM group and the vehicle-treated group (both P < 0.0001). There was no significant difference between these two groups. Dexamethasone treatment significantly suppressed ICAM-1 mRNA expression (70.0%; P < 0.0001), compared with vehicle treatment. This finding was substantiated by enzyme-linked immunosorbent assay (ELISA, Fig. 6 ). The ICAM-1 protein levels in the retina of the untreated DM group and the vehicle-treated group at 2 days after dexamethasone injection were 2.1- and 2.3-fold as high as that in the nondiabetic control group (P = 0.0011 and P = 0.0003), respectively, and there was no significant difference between the two groups. Dexamethasone treatment significantly reduced the ICAM-1 protein level (56.4%; P = 0.0003), compared with vehicle treatment.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 5. Gene expression of ICAM-1. The levels of gene expression are expressed as ratios to the average value of control rats. Data are the mean ± SEM (n = 6 in each group) *P < 0.0001 compared with control rats. {dagger}P < 0.0001 compared with vehicle-treated rats.

 


View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 6. ICAM-1 protein levels in the retina were quantitatively measured by ELISA. Data are the mean ± SEM (n = 6 in each group). *P < 0.005 compared with control rats. {dagger}P < 0.001 compared with vehicle-treated rats.

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, the leukostasis and BRB breakdown induced by diabetes were suppressed by intravitreal injection of dexamethasone. This indicates, for the first time, that intravitreal corticosteroid improves diabetic retinal edema by inhibiting leukocyte recruitment in the diabetic retina in vivo.

To date, there have been two major hypotheses for the mechanism of intravitreal corticosteroid action in BRB breakdown: (1) that corticosteroids may reduce retinal capillary permeability by increasing the activity and/or density of the tight junctions in the retinal capillary endothelium12 and (2) that corticosteroids may inhibit the metabolic pathway of the vascular endothelial growth factor (VEGF), a major vascular-permeability–increasing factor.13 14 However, there has been no in vivo study supporting the former hypothesis. The latter hypothesis is not well supported, because there is considerable evidence that corticosteroid does not change VEGF expression.15 16 After all, these two hypotheses do not fully explain the mechanism of intravitreal corticosteroid action.

Leukocyte adhesion to the vascular endothelium reportedly leads to junctional disorganization of endothelium.17 18 The junctional disorganization may increase vascular permeability, resulting in tissue edema. In diabetic retinas, the leukocytes that are adherent to vascular endothelium have been shown to cause capillary occlusion,5 endothelial cell apoptosis,19 20 and, finally, BRB breakdown.5 20 21 Furthermore, several studies implicate leukocytes as the major source of VEGF.22 23 24 Because corticosteroids can inhibit leukocyte migration25 and there is a close correlation between retinal leukostasis and BRB breakdown,9 it is possible that dexamethasone inhibits leukocyte recruitment in retinal microcirculation and thus reduces BRB breakdown. Given the previous reports about leukocyte functions and corticosteroid’s effect on leukocyte recruitment, we hypothesized that intravitreal corticosteroid may improve diabetic retinal edema by amelioration of BRB breakdown by inhibiting leukocyte recruitment in the diabetic retina.

In diabetic retinopathy, the expression of ICAM-1 on vascular endothelial cells is upregulated.5 26 27 Upregulated ICAM-1 enhances leukocyte adhesion to the vascular endothelium and leukostasis in the retina, as do other related molecules, including platelet endothelial cell adhesion molecule, vascular cell adhesion molecule, and the selectins.5 In the present study, the expression of ICAM-1and its protein level were downregulated by intravitreal injection of corticosteroid. This indicates that intravitreal corticosteroid inhibits ICAM-1-mediated leukocyte–endothelial cell interaction, a critical step in the development of diabetic retinopathy. In other words, intravitreal corticosteroid exerts beneficial effects in the prevention of diabetic retinopathy through suppressing ICAM-1-mediated leukocyte adhesion to vessel walls.

In the present study, the data show that leukostasis was reduced and BRB breakdown was ameliorated in the diabetic retina by intravitreal injection of dexamethasone. We believe that there is a strong relation between these two observations that supports our hypothesis that intravitreal corticosteroid may improve diabetic retinal edema by amelioration of BRB breakdown by inhibiting leukostasis, rather than the other two hypotheses.

In conclusion, in this in vivo study, intravitreal corticosteroid attenuated leukostasis and BRB breakdown in diabetic retinal edema. The findings indicate that intravitreal corticosteroid may improve BRB breakdown and then diabetic retinal edema by inhibiting leukostasis.


    Footnotes
 
Supported by a grant from the Japan National Society for the Prevention of Blindness and a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science.

Submitted for publication July 29, 2004; revised November 5 and December 9, 2004; accepted December 20, 2004.

Disclosure: H. Tamura, None; K. Miyamoto, None; J. Kiryu, None; S. Miyahara, None; H. Katsuta, None; F. Hirose, None; K. Musashi, None; N. Yoshimura, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Kazuaki Miyamoto, Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, Sakyo, Kyoto 606-8507, Japan; kazuaki{at}kuhp.kyoto-u.ac.jp.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Massin P, Audren F, Haouchine B, et al. Intravitreal triamcinolone acetonide for diabetic diffuse macular edema: preliminary results of a prospective controlled trial. Ophthalmology. 2004;11:218–224.[CrossRef]
  2. Jonas JB, Kreissig I, Sofker A, Degenring RF. Intravitreal injection of triamcinolone for diffuse diabetic macular edema. Arch Ophthalmol. 2003;121:57–61.[Abstract/Free Full Text]
  3. Martidis A, Duker JS, Greenberg PB, et al. Intravitreal triamcinolone for refractory diabetic macular edema. Ophthalmology. 2002;109:920–927.[CrossRef][ISI][Medline][Order article via Infotrieve]
  4. Miyamoto K, Hiroshiba N, Tsujikawa A, Ogura Y. In vivo demonstration of increased leukocyte entrapment in retinal microcirculation of diabetic rats. Invest Ophthalmol Vis Sci. 1998;39:2190–2194.[Abstract/Free Full Text]
  5. Miyamoto K, Khosrof S, Bursell SE, et al. Prevention of leukostasis and vascular leakage in streptozotocin-induced diabetic retinopathy via intercellular adhesion molecule-1 inhibition. Proc Natl Acad Sci USA. 1999;96:10836–10841.[Abstract/Free Full Text]
  6. Nishiwaki H, Ogura Y, Kimura H, Kiryu J, Honda Y. Quantitative evaluation of leukocyte dynamics in retinal microcirculation. Invest Ophthalmol Vis Sci. 1995;36:123–130.[Abstract/Free Full Text]
  7. Nishiwaki H, Ogura Y, Kimura H, Kiryu J, Miyamoto K, Matsuda N. Visualization and quantitative analysis of leukocyte dynamics in retinal microcirculation of rats. Invest Ophthalmol Vis Sci. 1996;37:1341–1347.[Abstract/Free Full Text]
  8. Miyahara S, Kiryu J, Yamashiro K, et al. Simvastatin inhibits leukocyte accumulation and vascular permeability in the retinas of rats with streptozotocin-induced diabetes. Am J Pathol. 2004;164:1697–1706.[Abstract/Free Full Text]
  9. Ishida S, Usui T, Yamashiro K, et al. VEGF164 is proinflammatory in the diabetic retina. Invest Ophthalmol Vis Sci. 2003;44:2155–2162.[Abstract/Free Full Text]
  10. Yamashiro K, Tsujikawa A, Ishida S, et al. Platelets accumulate in the diabetic retinal vasculature following endothelial death and suppress blood-retinal barrier breakdown. Am J Pathol. 2003;163:253–259.[Abstract/Free Full Text]
  11. Hirose F, Kiryu J, Miyamoto K, et al. In vivo evaluation of retinal injury after transient ischemia in hypertensive rats. Hypertension. 2004;43:1098–1102.[Abstract/Free Full Text]
  12. Antonetti DA, Wolpert EB, DeMaio L, Harhaj NS, Scaduto RC, Jr. Hydrocortisone decreases retinal endothelial cell water and solute flux coincident with increased content and decreased phosphorylation of occludin. J Neurochem. 2002;80:667–677.[CrossRef][ISI][Medline][Order article via Infotrieve]
  13. Kompella UB, Bandi N, Ayalasomayajula SP. Subconjunctival nano- and microparticles sustain retinal delivery of budesonide, a corticosteroid capable of inhibiting VEGF expression. Invest Ophthalmol Vis Sci. 2003;44:1192–1201.[Abstract/Free Full Text]
  14. Fischer S, Renz D, Schaper W, Karliczek GF. In vitro effects of dexamethasone on hypoxia-induced hyperpermeability and expression of vascular endothelial growth factor. Eur J Pharmacol. 2001;411:231–243.[CrossRef][ISI][Medline][Order article via Infotrieve]
  15. Hasan Q, Tan ST, Gush J, Peters SG, Davis PF. Steroid therapy of a proliferating hemangioma: histochemical and molecular changes. Pediatrics. 2000;105:117–120.[Abstract/Free Full Text]
  16. Gao H, Qiao X, Gao R, Mieler WF, McPherson AR, Holz ER. Intravitreal triamcinolone does not alter basal vascular endothelial growth factor mRNA expression in rat retina. Vision Res. 2004;44:349–356.[CrossRef][ISI][Medline][Order article via Infotrieve]
  17. Bolton SJ, Anthony DC, Perry VH. Loss of the tight junction proteins occludin and zonula occludens-1 from cerebral vascular endothelium during neutrophil-induced blood-brain barrier breakdown in vivo. Neuroscience. 1998;86:1245–1257.[CrossRef][ISI][Medline][Order article via Infotrieve]
  18. Del Maschio A, Zanetti A, Corada M, et al. Polymorphonuclear leukocyte adhesion triggers the disorganization of endothelial cell-to-cell adherens junctions. J Cell Biol. 1996;135:497–510.[Abstract/Free Full Text]
  19. Joussen AM, Murata T, Tsujikawa A, Kirchhof B, Bursell SE, Adamis AP. Leukocyte-mediated endothelial cell injury and death in the diabetic retina. Am J Pathol. 2001;158:147–152.[Abstract/Free Full Text]
  20. Joussen AM, Poulaki V, Mitsiades N, et al. Suppression of Fas-FasL-induced endothelial cell apoptosis prevents diabetic blood-retinal barrier breakdown in a model of streptozotocin-induced diabetes. FASEB J. 2003;17:76–78.[Abstract/Free Full Text]
  21. Joussen AM, Poulaki V, Qin W, et al. Retinal vascular endothelial growth factor induces intercellular adhesion molecule-1 and endothelial nitric oxide synthase expression and initiates early diabetic retinal leukocyte adhesion in vivo. Am J Pathol. 2002;160:501–509.[Abstract/Free Full Text]
  22. Grossniklaus HE, Ling JX, Wallace TM, et al. Macrophage and retinal pigment epithelium expression of angiogenic cytokines in choroidal neovascularization. Mol Vis. 2002;8:119–126.[ISI][Medline][Order article via Infotrieve]
  23. Yi X, Ogata N, Komada M, et al. Vascular endothelial growth factor expression in choroidal neovascularization in rats. Graefes Arch Clin Exp Ophthalmol. 1997;235:313–319.[CrossRef][ISI][Medline][Order article via Infotrieve]
  24. McLaren J, Prentice A, Charnock-Jones DS, et al. Vascular endothelial growth factor is produced by peritoneal fluid macrophages in endometriosis and is regulated by ovarian steroids. J Clin Invest. 1996;98:482–489.[ISI][Medline][Order article via Infotrieve]
  25. Bucala R. Neuroimmunomodulation by macrophage migration inhibitory factor (MIF). Ann NY Acad Sci. 1998;840:74–82.[Abstract/Free Full Text]
  26. McLeod DS, Lefer DJ, Merges C, Lutty GA. Enhanced expression of intracellular adhesion molecule-1 and P-selectin in the diabetic human retina and choroid. Am J Pathol. 1995;147:642–653.[Abstract]
  27. Nozaki M, Ogura Y, Hirabayashi Y, Saishin Y, Shimada S. Enhanced expression of adhesion molecules of the retinal vascular endothelium in spontaneous diabetic rats. Ophthalmic Res. 2002;34:158–164.[CrossRef][ISI][Medline][Order article via Infotrieve]



This article has been cited by other articles:


Home page
DiabetesHome page
X. Zhang, S. Bao, D. Lai, R. W. Rapkins, and M. C. Gillies
Intravitreal Triamcinolone Acetonide Inhibits Breakdown of the Blood-Retinal Barrier Through Differential Regulation of VEGF-A and Its Receptors in Early Diabetic Rat Retinas
Diabetes, April 1, 2008; 57(4): 1026 - 1033.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
S. Mizuno, A. Nishiwaki, H. Morita, T. Miyake, and Y. Ogura
Effects of Periocular Administration of Triamcinolone Acetonide on Leukocyte-Endothelium Interactions in the Ischemic Retina
Invest. Ophthalmol. Vis. Sci., June 1, 2007; 48(6): 2831 - 2836.
[Abstract] [Full Text] [PDF]


Home page
Arch OphthalmolHome page
F. Bandello, A. Polito, D. R. Pognuz, P. Monaco, A. Dimastrogiovanni, and J. Paissios
Triamcinolone as adjunctive treatment to laser panretinal photocoagulation for proliferative diabetic retinopathy.
Arch Ophthalmol, May 1, 2006; 124(5): 643 - 650.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
O. Uckermann, F. Kutzera, A. Wolf, T. Pannicke, A. Reichenbach, P. Wiedemann, S. Wolf, and A. Bringmann
The Glucocorticoid Triamcinolone Acetonide Inhibits Osmotic Swelling of Retinal Glial Cells via Stimulation of Endogenous Adenosine Signaling
J. Pharmacol. Exp. Ther., December 1, 2005; 315(3): 1036 - 1045.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
R. A. Feit-Leichman, R. Kinouchi, M. Takeda, Z. Fan, S. Mohr, T. S. Kern, and D. F. Chen
Vascular Damage in a Mouse Model of Diabetic Retinopathy: Relation to Neuronal and Glial Changes
Invest. Ophthalmol. Vis. Sci., November 1, 2005; 46(11): 4281 - 4287.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tamura, H.
Right arrow Articles by Yoshimura, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tamura, H.
Right arrow Articles by Yoshimura, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS