| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
From the Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, Kyoto, Japan.
 |
Abstract |
|---|
 Top Abstract MethodsResultsDiscussionReferences |
|---|
METHODS. Argon laser photocoagulation was performed in one half of the retina in pigmented male rats (n = 114). Argatroban was administered just before scatter laser photocoagulation. In the other half of the retina, AO leukocyte fluorography was used to evaluate in vivo leukocyte rolling along the retinal vein and accumulation in the retinal capillary bed. The expressions of P-selectin and intercellular adhesion molecule (ICAM)-1 were evaluated by reverse transcription–polymerase chain reaction. Retinal vessel permeability was quantified by using fluorescein isothiocyanate (FITC)-conjugated dextran.
RESULTS. Scatter laser photocoagulation caused significant inflammatory leukocyte–endothelial cell interactions in the nonphotocoagulated half of the retina. Treatment with argatroban suppressed leukocyte–endothelial cell interactions. The maximum number of rolling and accumulating leukocytes was reduced by 46.6% (P < 0.01) and 51.4% (P < 0.01), respectively. The expression of P-selectin and ICAM-1 mRNA was suppressed significantly in the argatroban-treated retinas (P < 0.05). Retinal vascular permeability was also suppressed significantly (P < 0.05).
CONCLUSIONS. Argatroban suppressed leukocyte–endothelial cell interactions and blood–retinal barrier breakdown after scatter laser photocoagulation, suggesting that argatroban prevents postlaser macular edema.
We have developed a method of acridine orange (AO) leukocyte fluorography that allows us to visualize leukocytes and to evaluate quantitatively their behavior in the retinal microcirculation in vivo.4 5 Using this method, we demonstrated impaired leukocyte flow in the untreated portion of the retina after partial scatter laser photocoagulation.6 Moreover, we showed that inflammatory leukocyte–endothelial interactions were present in both the photocoagulated and nonphotocoagulated halves of the retina and demonstrated a significant increase of vascular permeability in the nonphotocoagulated portions of the retina 7 days after photocoagulation.7 We hypothesized that leukocyte recruitment in the nonphotocoagulated posterior pole plays a role in the pathogenesis of macular edema after scatter laser photocoagulation.
When endothelial cells are activated, they express adhesion molecules that lead to leukocyte–endothelial cell interactions through a multistep process.8 9 Initially, leukocytes interact with P-selectin, which is expressed on endothelial cells, and begin rolling along vessel walls. The leukocytes then interact with intracellular adhesion molecule (ICAM)-1, adhere to endothelial cells, and migrate out of the vessels. In this adhesion cascade, leukocytes are activated, finally injure the tissue, and may be responsible for increased microvascular permeability under inflammatory conditions.10 11
Recently, some investigators have shown that anticoagulant therapy attenuates inflammatory reactions, such as leukocyte–endothelial cell interactions or fibrin formation.12 13 14 15 Argatroban, a selective thrombin inhibitor, is clinically used in vascular vessel-occlusive diseases16 17 because it binds directly to the active site of thrombin and inhibits its function.18 19 With the use of argatroban, prothrombin time (PT), showing the extrinsic coagulation pathway, and activated partial thromboplastin time (APTT), showing the intrinsic coagulation pathway, have been prolonged, and platelet aggregation has been shown to be inhibited.19 20
The purpose of this study was to evaluate quantitatively the inhibitory effects of argatroban on leukocyte–endothelial cell interactions and retinal vascular permeability in the nonphotocoagulated portions of the retina, after partial scatter laser photocoagulation.
|
Methods |
|---|
|
TopAbstractMethodsResultsDiscussionReferences |
|---|
|
Peripheral blood specimens were collected to count the number of leukocytes and platelets with the use of a hematology system (Erma; Bayer Diagnostics, Munich, Germany) and to measure the PT and APTT at various time points. All experiments were performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.
AO Leukocyte Fluorography
At 12, 18, 24, 36, and 48 hours after 400 spots of photocoagulation were applied, AO leukocyte fluorography was performed. Six rats in both the argatroban-treated and vehicle-treated groups were used at each time point. Another six nonsurgical rats served as the control. To evaluate leukocyte–endothelial cell interactions after retinal scatter laser photocoagulation, we used AO leukocyte fluorography, which has been described in detail elsewhere.4 5 In brief, a scanning laser ophthalmoscope (SLO; Rodenstock Instruments, Munich, Germany), coupled with a computer-assisted image-analysis system, made continuous, high-resolution images of the fundus stained by metachromatic fluorochrome AO (Wako Pure Chemicals, Osaka, Japan). For further analysis, the obtained images were recorded on an S-VHS videotape at a rate of 30 frames/s. Immediately before AO leukocyte fluorography, the rats were anesthetized, and the pupils were dilated. A contact lens was used to retain corneal clarity throughout the experiment. Arterial blood pressure was monitored with a blood pressure analyzer (IITC Life Sciences, Woodland Hills, CA). AO (0.1% solution in saline) was injected continuously through the tail vein catheter for 1 minute at a rate of 1 mL/min. Rolling leukocytes were defined as leukocytes that moved at a velocity slower than that of free-flowing leukocytes. The number of rolling leukocytes was calculated from the number of cells per minute crossing a fixed area of the vessel at a distance of two disc diameters from the optic disc center. At 30 minutes after the injection of AO, the fundus was observed again, to evaluate leukocyte accumulation in the retinal microcirculation. The number of fluorescent dots was counted in 1-mm2 areas of the nonphotocoagulated portions of the retina at a distance of 1 disc diameter from the edge of the optic disc.
Semiquantification of P-selectin and ICAM-1 Gene Expression
After 12 and 24 hours of photocoagulation, one eye of each of the six rats in the argatroban-treated, vehicle-treated, and nonsurgical control groups was enucleated. Total RNA was isolated from the retina according to the acid guanidinium-thiocyanate-phenol-chloroform extraction method.21 The extracted RNA was quantified, and then 2 µg was used to make cDNA, with a kit (Omniscript reverse transcriptase; Qiagen, Hilden, Germany). Polymerase chain reaction was performed by the method of Saiki et al.22 with slight modification. The following conditions were used: denaturation at 94°C for 1 minute, annealing at 62°C for 1 minute, and polymerization at 72°C for 1 minute. The reaction was performed for 31 cycles. The primers were TGCTTGGCTACTGGACACTG (sense) and GGTGTCGACAGGACATTGTG (antisense) for P-selectin, AGCCTCAGGCCTAAGAGGAC (sense) and AGGGGTCCCAGAGAGGTCTA (antisense) for ICAM-I, and GGCATCCTGACCCTGAAGTA (sense) and GCCATCTCTTGCTCGAAGTC (antisense) for ß-actin. Nucleotide sequencing and restriction pattern analysis confirmed that polymerase chain reaction products were derived from the target cDNA sequences.
Measurement of Retinal Vessel Permeability with FITC-Dextran
Retinal blood vessel leakage in the rat was quantitated at 168 hours after 400 spots of photocoagulation, as previously described in detail.23 After deep anesthesia with xylazine hydrochloride and ketamine hydrochloride, fluorescein isothiocyanate (FITC)–conjugated dextran (4.4 kDa, 50 mg/mL in PBS, 50 mg/kg body weight; Sigma-Aldrich, Tokyo, Japan) was injected intravenously. After 10 minutes, the chest cavity was opened, and a 14-gauge perfusion cannula was introduced into the aorta. A blood sample was collected immediately before perfusion. After drainage from the right atrium was achieved, each rat was perfused with PBS (500 mL/kg body weight), to clear the remaining intravascular dextran. The blood sample was centrifuged at 7000 rpm for 20 minutes at 4°C, and the supernatant was diluted at 1:1000. Immediately after perfusion, one eye from each of six rats in the argatroban-treated, vehicle-treated, and nonsurgical control groups was enucleated. The nonphotocoagulated portions of the retina were carefully removed, weighed, and homogenized to extract the FITC-dextran in 0.4 mL of water. The extract was processed through a 30,000-molecular-weight filter (Ultrafree-MC; Millipore, Bedford, MA) at 7000 rpm for 90 minutes at 4°C. The fluorescence in each 300-µL sample was measured (excitation, 485 nm; emission, 538 nm) with a spectrofluorometer (SPECTRAmax GEMINI XS; Molecular Devices, Sunnyvale, CA) with water as a blank. Corrections were made by subtracting the autofluorescence of retinal tissue from rats without FITC-dextran injection. The amount of FITC-dextran in each retina was calculated from a standard curve of FITC-dextran in water. For normalization, the retinal FITC-dextran amount was divided by retinal weight and by the concentration of FITC-dextran in the plasma.
Statistical Analysis
All data are presented as the mean ± SD. Student’s t-test was used to compare two groups. ANOVA was used to compare three or more conditions, with post hoc comparisons tested with the Fisher protected least-significant difference procedure. Differences were considered statistically significant at P < 0.05.
|
Results |
|---|
|
TopAbstractMethodsResultsDiscussionReferences |
|---|
|
Leukocyte Rolling
Immediately after AO was infused intravenously, only leukocytes were stained among the circulating blood cells. No rolling leukocytes were observed in the nonsurgical control group. In the laser-treated rats, some leukocytes were observed slowly rolling along major retinal veins but not along any major retinal arteries. In the vehicle-treated group, the flux of rolling leukocytes increased substantially and peaked at 18 hours after scatter laser photocoagulation (12.4 ± 3.1 cells/min). In the argatroban-treated group, leukocyte rolling was significantly inhibited compared with that in the vehicle-treated group (P < 0.001; Fig. 3A ). The number of rolling leukocytes in the argatroban-treated group was reduced to 46.6% of that in the vehicle-treated group at 18 hours after photocoagulation (P < 0.0051).
|
Figure 3C shows accumulated leukocytes after AO injection. A small number of leukocytes was found in control rats. An increasing number of leukocytes accumulated at 24 hours after photocoagulation in the vehicle-treated group. A significant reduction of leukocyte accumulation was seen in the argatroban-treated group.
P-selectin and ICAM-I Gene Expression
The levels of gene expression are shown as a ratio to the average values of nonsurgical control rats (Fig. 4) . ICAM-I mRNA expression was upregulated in the vehicle-treated group (P = 0.0006) and was significantly suppressed in the argatroban-treated group at 24 hours after retinal scatter laser photocoagulation (P = 0.016). P-selectin mRNA expression was also upregulated in the vehicle-treated group (P = 0.0090) and was significantly suppressed in the argatroban-treated group (P = 0.046) at 12 hours after photocoagulation.
|
|
|
Discussion |
|---|
|
TopAbstractMethodsResultsDiscussionReferences |
|---|
We previously showed that inflammatory leukocyte–endothelial interactions were observed in both the photocoagulated and the nonphotocoagulated halves of rat retina and demonstrated a significant increase of vascular permeability in the nonphotocoagulated portions.7 An investigation using the fluorophotometric technique developed by Taguchi et al.24 has demonstrated that hydrogen peroxide diffused into the vitreous after retinal scatter photocoagulation. Hydrogen peroxide was found to induce upregulation of adhesion molecules on the vascular endothelium and subsequent leukocyte–endothelial interactions.25 Accordingly, scatter photocoagulation may cause inflammatory leukocyte behavior, such as rolling and accumulation in the nonphotocoagulated retina through oxidative stress-induced upregulation of adhesion molecules on the vascular endothelium.
Recent evidence suggests that leukocytes and platelets play a critical role in disrupting the microvascular barrier in various organs.26 27 28 These reports have suggested that leukocyte–endothelial contact, such as leukocyte adhesion on the vascular endothelium and subsequent leukocyte extravasation, may be responsible for increased microvascular permeability under inflammatory conditions. Using AO leukocyte fluorography, we have demonstrated in vivo that platelet depletion suppresses leukocyte rolling and subsequent accumulation in postischemic tissues.26 Platelets adhering to vascular endothelium contribute to the recruitment of leukocytes through the expression of P-selectin on their surfaces and participate in leukocyte-dependent tissue injury.26 Moreover, thrombin activates platelets and causes them to produce inflammatory mediators, such as serotonin, leukotrienes, thromboxane A2, monocyte chemotactic protein-3, and platelet-derived growth factor.29 30 Some investigators have shown that anticoagulant therapy attenuates the inflammatory reactions, such as leukocyte–endothelial cell interactions, or fibrin formation.12 13 14 15 We demonstrated previously that argatroban could also suppress leukocyte- and platelet–endothelial cell interactions in the postischemic rat retina and that the expression of mRNA of P-selectin and ICAM-I was suppressed significantly in the argatroban-treated retina.15 We hypothesized that argatroban, a selective thrombin inhibitor, has a potential effect on the blood–retinal barrier breakdown by inhibition of the aggregation of platelets.
Wilson et al.31 showed the gene expression in the mouse retina 3 days after argon laser photocoagulation, as determined by microarray analysis. In their study, both genes, P-selectin and ICAM-I, were not the upregulated ones. Conversely, our results showed mRNA upregulation of these adhesion molecules in the nonphotocoagulated portions of the retina. The time course of postlaser reaction may account for these conflicting results, as reported by Wilson et al. and us. In the acute phase, the mRNA expressions of these adhesion molecules were upregulated after scatter laser photocoagulation. Then, argatroban inhibited the mRNA expressions of these adhesion molecules. The suppressed leukocyte–endothelial cell interactions in the postlaser retina of argatroban-treated rats were associated with the suppressed expressions of these adhesion molecules.
In conclusion, we have demonstrated that argatroban can attenuate leukocyte–endothelial cell interactions and blood–retinal barrier breakdown in the nonphotocoagulated portions of the retina after partial scatter laser photocoagulation. These results suggest that argatroban attenuates the development of macular edema by inhibiting inflammatory reactions mediated by leukocytes and platelets. Argatroban may have a therapeutic effect on macular edema after photocoagulation.
|
Footnotes |
|---|
Submitted for publication September 16, 2004; revised February 14, 2005; accepted March 3, 2005.
Disclosure: K. Musashi, None; J. Kiryu, None; K. Miyamoto, None; S. Miyahara, None; H. Katsuta, None; H. Tamura, None; F. Hirose, None; N. Yoshimura, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. 
1734 solely to indicate this fact.
Corresponding author: Kazuaki Miyamoto, Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, 54, Kawara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan; kazuaki{at}kuhp.kyoto-u.ac.jp.
|
References |
|---|
|
TopAbstractMethodsResultsDiscussionReferences |
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
