|
|
||||||||
1From the Department of Pharmacology and Therapeutics, McGill University, Montréal, Québec, Canada; the 2Departments of Paediatrics, Ophthalmology, and Pharmacology, Research Center, Ste. Justine Hospital, Université de Montréal, Montreal, Québec, Canada; 3INSERM U. 598 Physiopathologie des Maladies Oculaires: Innovations Thérapeutiques, Paris, France; and the 4Faculty of Pharmacy, Université de Montréal, Montréal, Québec, Canada.
| Abstract |
|---|
|
|
|---|
METHODS. In a murine model of inflammatory CNV, CD36 expression was evaluated by RT-PCR and immunofluorescence. Mice subjected to CNV were treated topically (thrice daily) with CD36 functionally neutralizing antibodies against the oxidized low-density lipoprotein (oxLDL) and thrombospondin (TSP)-1 sites (clones JC63.1 and FA6-152, respectively). Neovascularization was analyzed by CD31-immunostained corneal flatmounts. The role of the less characterized oxLDL site during angiogenesis was elucidated by using the CD36 ligand 1-palmitoyl 2-(5'-oxovaleroyl) phosphatidylcholine (POVPC; 50, 100 µg/mL) 24 hours after corneal injury for 7 days, whereas in angioregressive studies, POVPC treatments were initiated 10 days after induction of CNV. In this process, VEGF expression was also studied. Effects of CD36 activation were further examined ex vivo using the mouse aortic ring assay.
RESULTS. CD36 expression was upregulated after corneal injury; CD36 was expressed in corneal epithelium, limbus, invading microvessels, and stromal macrophages. Blocking CD36 activity with FA6-152 significantly increased CNV (P <0.001). Conversely, activating CD36 with POVPC dose dependently inhibited CNV (P = 0.003); this effect was blocked by JC61.3. POVPC also significantly regressed preformed blood vessels (P < 0.001). Ex vivo experiments on aortic rings confirmed the angioinhibitory and -regressive effects of POVPC. Because corneal macrophages express CD36 and may partake in angiogenesis via VEGF-A secretion, we surmised that VEGF-A could be modulated by CD36. Indeed, POVPC downregulated VEGF-A expression in a time-dependent fashion (P < 0.001), whereas FA6-152 induced its expression (P < 0.05).
CONCLUSIONS. CD36 is involved both physiologically and pharmacologically in inhibition and regression of CNV, by direct effect on endothelial cells and partly by negatively regulating VEGF expression in macrophages.
Although vascular endothelial growth factor (VEGF) is known to be a potent stimulator of corneal neovascularization (CNV), 9 10 the molecular basis of this condition remains poorly defined. It is well known, however, that transmigrating and invading macrophages are closely associated with neovascularization and provide much of the requisite VEGF that drives this process.11 12
The class B scavenger receptor CD36 is a transmembrane glycoprotein that has been identified as the critical receptor for thrombospondin (TSP)-1, a potent endogenous inhibitor of angiogenesis,13 14 15 including that which occurs in the cornea.16 CD36 also binds to a variety of other ligands including oxidized low-density lipoproteins (oxLDLs),17 18 oxidized phospholipids (oxPLs),19 20 21 22 Plasmodium falciparuminfected erythrocytes,23 collagen,24 and apoptotic cells.25 Expression of CD36 is broad and encompasses microvascular endothelial cells (ECs), monocytes/macrophages, platelets, conjunctival dendriform cells, and the retinal pigment epithelium.25 26 27 28 Furthermore, CD36 has been implicated in a wide variety of normal and abnormal biological functions, including angiogenesis, atherosclerosis, phagocytosis, inflammation, lipid metabolism, and removal of apoptotic cells.25
With respect to its angiostatic functions, CD36 is essential for inhibiting in vitro EC migration and the formation of capillary-like structures by TSP-1.15 CD36 plays a critical role in vivo, as demonstrated by the inability of TSP-1 to inhibit angiogenesis in CD36 null mice.29 We have also recently demonstrated the specific involvement of CD36 and TSP-1 in mediating antiangiogenic signals in ischemic proliferative retinopathy.30 31 Nevertheless, the involvement of CD36 and the relative role of its less well-characterized oxidized lipid-binding site in regulating pathologic corneal angiogenesis has not yet been fully elucidated. We herein report that expression of CD36 in macrophages and microvascular endothelial cells after corneal injury suppresses CNV. This effect can be ascribed to the proapoptotic antiangiogenic property of CD36 on endothelial cells, as well as partly to a downregulation of VEGF from CD36-expressing macrophages.
| Materials and Methods |
|---|
|
|
|---|
Murine Model of CNV
The CNV model used in our studies is characterized by the removal of the corneal and limbal epithelium by means of a chemical and mechanical injury to the cornea. This causes resurfacing of the cornea by a conjunctiva-like epithelium replete with blood vessels. The neovascularization persists for at least 8 weeks and is accompanied by inflammation.9
All mice used for inflammation-induced CNV experiments were between 6 and 8 weeks of age. Each mouse was anesthetized before all surgical procedures with isoflurane (Abbott, Montréal, Québec, Canada). Topical proparacaine (Alcon Canada, Mississauga, Ontario) and 2 µL of 0.15 M NaOH were applied to the central cornea of each mouse. The corneal and limbal epithelia were removed by scraping with a no. 23 scalpel. Gentamicin sulfate ophthalmic solution (Sabex, Inc., Boucherville, Québec, Canada) was instilled immediately after epithelial denudation, three times daily for 2 days. Buprenorphine (0.05 mg/kg; Schering-Plough, Ltd., Pointe Claire, Québec, Canada) was administered after surgery for analgesia.
Pharmacological Treatment of Mice with CNV
C57BL/6 mice undergoing inflammation-induced angiogenesis were randomly divided into four groups. Twenty-four hours after corneal injury, one group received treatment with 100 µg/mL of an anti-CD36 monoclonal antibody (mAb) against the oxLDL binding site (clone JC63.1 IgA mouse; Cayman Chemical, Ann Arbor, MI) or an isotype control antibody (100 µg/mL anti-mouse IgA; Sigma-Aldrich, St. Louis, MO). A second group was treated with 200 µg/mL of an anti-CD36 mAb against the TSP-1-binding site (clone FA6-152 IgG1 mouse; Beckman Coulter, Fullerton, CA) or 200 µg/mL anti-mouse IgG1 (Sigma-Aldrich). The third group was administered vehicle (99% 0.9% NaCl and 1% ethanol) or 50 or 100 µg/mL POVPC (1-palmitoyl 2-(5'-oxovaleroyl) phosphatidylcholine; Cayman Chemical). In the fourth group, vehicle (99% 0.9% NaCl and 1% ethanol) or 100 µg/mL POVPC treatments were administered 10 days after surgery for angioregression studies. All treatments were administered topically three times daily for 7 days, after which corneas were harvested for immunostaining. In another set of experiments, one group of mice underwent vehicle (99% 0.9% NaCl and 1% ethanol) or 100 µg/mL POVPC treatments for 2 and 4 days, whereas a second group was treated with 200 µg/mL IgG1 or 200 µg/mL FA6-152 for 4 days. The corneas were subsequently dissected and processed for RNA extraction and RT-PCR analysis. In all experiments, the treatment groups consisted of 10 mice per group, and each set of experiments was repeated at least two times.
Labeling and Quantification of CNV
Visualization of vascular endothelial cells was performed by immunostaining corneal flatmounts with FITC-conjugated anti-CD31, as previously described,6 or with FITC-conjugated ICAM-1, to demonstrate activated vascular endothelial cells. Fresh corneas were dissected, rinsed in 0.1 M PBS for 30 minutes, and fixed in 100% ice-cold acetone for 25 minutes. After the specimens were washing in 0.1 M PBS, nonspecific binding was blocked with 0.1 M PBS, 2% bovine serum albumin (BSA; Sigma-Aldrich) for 1 hour at room temperature. Incubation with FITC-conjugated anti-CD31 (1:300; BD Pharmingen, San Diego, CA) or ICAM1-FITC (1:100, Abcam Plc, Cambridge, UK) in 0.1 M PBS, 2% BSA at 4°C overnight was followed by subsequent washes in 0.1 M PBS at room temperature. Corneas were mounted with an anti-fade agent (Gelmount; Biomeda, Inc., San Francisco, CA) and observed with an epifluorescence microscope (Eclipse E800; Nikon, Tokyo, Japan). Images were captured with a digital camera (DXM 1200, with ACT 1, ver. 2.62 software; Nikon).
The CNV was quantified in a masked fashion with image-analysis software (Photoshop 7.0; Adobe, Mountain View, CA). The entire flatmounted cornea was analyzed, to minimize sampling bias. The total corneal surface area was outlined with the innermost vessel of the limbal arcade as the border and the ratio [(neovascularized area/total cornea area) x 100] was used to provide a measure of the percentage of vascularized cornea.6
Immunostaining of Corneal Frozen Sections
Mice were killed 7 days after corneal injury. Enucleated eyes were fixed in 4% paraformaldehyde, transferred to 30% sucrose/PBS overnight at 4°C, washed with PBS, and embedded in optimal cutting temperature (OCT) medium (Sakura Finetek, Torrance, CA). Sixteen-micrometer frozen sections were washed with 0.1% Triton X-100/PBS and blocked for 1 hour with 2% BSA before overnight incubation with rabbit polyclonal CD36 (1:100; Santa Cruz Biotechnology, Santa Cruz, CA). The sections were subsequently incubated with a goat anti-rabbit secondary antibody (1:1000; Invitrogen-Molecular Probes, Eugene, OR), preceded by a 1-hour incubation with a TRITC-conjugated lectin endothelial cell marker from Griffonia simplicifolia (1:100, Sigma-Aldrich, Inc.). Cell nuclei were labeled with the nucleic acid stain 4',6-diamidino-2-phenylindole (DAPI, 300 nM; Invitrogen-Molecular Probes). In negative control experiments, the CD36 primary antibody was omitted, and sections were incubated with 0.1% Triton X-100/PBS followed by the goat anti-rabbit secondary antibody and DAPI. Images were visualized by epifluorescence microscopy.
RNA Extraction and RT-PCR Analysis
The eyes were enucleated and the corneas dissected and immediately placed in stabilization solution (RNAlater; Ambion, Inc., Austin, TX). Total RNA (n = 10 per group) was extracted with a standard RNA isolation protocol (TRIzol; Invitrogen, Inc., Carlsbad, CA). cDNA was synthesized from 1 µg RNA with M-MLV reverse transcriptase (Promega, Inc., Madison, WI) according to the manufacturers instructions. The following primers were used for PCR from 5' to 3': CD36 sense, GATGACGTGGCAAAGAACAG; CD36 antisense, AAAGGAGGCTGCGTCTGTG; VEGF-A sense, ACTGGACCCTGGCTTTACTG; VEGF-A antisense, TATGTGCTGGCTTTGGTGAG; JNK-1 sense, TGTGGAATCAAGCACCTTCACTCTGCTG; JNK-1 antisense, GCAAAC CATTTCTCCCATAATGCACCC; c-JUN sense, ATGCCCTCAACGCCTCGTTCCTCC; c-JUN antisense, CTGCTCGTCGGTCACGTTCTTGGG; ß-actin sense, AGCCATGTACGRAGCCATCC; and ß-actin antisense, ATGCCACAGGATTCCATACC. 18S (Ambion, Inc.) also served as an internal control. PCR (Taq DNA polymerase; Invitrogen, Inc.) was performed under the following conditions: denaturation at 94°C, annealing at 56°C (CD36, ß-actin; VEGF-A: 65°C; JNK-1, c-JUN: 64°C; 18S: 60°C), and extension at 72°C. The predicted sizes of PCR products are 550, 350, 300, 350, 450, and 315 bp for CD36, VEGF-A, JNK-1, c-JUN, ß-actin, and 18S respectively. Densitometry values were measured in terms of pixel intensity (Image-Pro Plus software, ver. 4.1; Media Cybernetics, Silver Spring, MD).
Aortic Ring Angiogenesis Assay
This assay was performed as described previously by us and others.31 32 In brief, thoracic aortas were removed from 6-week-old mice killed by CO2 asphyxiation and immediately transferred to a culture dish containing ice-cold endothelial cell basal medium (EGM-2; Cambrex Bio Science, Walkersville, MD). The periaortic fibroadipose tissue was carefully removed with fine microdissecting forceps and scissors, paying special attention not to damage the aortic wall. One millimeterlong aortic rings (12 per aorta) were sectioned and rinsed extensively in eight consecutive washes of EGM-2. The rings were then individually embedded in 48-well plates previously coated with 50 µL synthetic basement membrane (Matrigel; BD Biosciences, Bedford, MA) per well. Next, an additional 50 µL of Matrigel was placed over each ring. After 1 hour, 500 µL EGM-2 was added to each well, and the cultures were incubated at 37°C for 5 days. The culture medium was changed on day 3 and the test compounds added. The test compounds and their concentrations were: vehicle (99% 0.9% NaCl and 1% ethanol) and POVPC (20 µg/mL), in the absence or presence of anti-CD36 antibodies (JC61.3, 6 µg/mL; FA6-152, 10 µg/mL). The aortic rings were photographed on day 5 at 4x magnification with an inverted microscope (Eclipse TE300; Nikon). For neovessel-regression experiments, the rings were cultured without drugs until day 6, after which the rings were treated with the test compound and allowed to grow until day 7. The angiogenic response was determined by measuring the area of neovessel formation on computer (Image Pro Plus software; Media Cybernetics, Inc.).
Immunostaining of Wholemount Corneal Stromas
Mice were subjected to corneal injury, after which corneal and limbal tissue were excised at day 7 and subsequently prepared for staining as wholemounts, as previously described.33 Briefly, the corneal epithelium was separated after a 20-minute incubation at 37°C in 20 mM EDTA (Sigma-Aldrich). The resultant corneal stromas were then fixed for 30 minutes at 4°C in 1% paraformaldehyde-PBS followed by extensive washing in PBS. After fixation, the corneal tissue was blocked for 1 hour in PBS-GEN (PBS containing 3% BSA, 0.25% gelatin, 5 mM EDTA, and 0.025% Nonidet-P40) and then processed for double immunofluorescence with rabbit polyclonal CD36 (1:100, Santa Cruz Biotechnology), rabbit anti-mouse vascular endothelial growth factor A (VEGF-A; 1:100; Chemicon International, Inc.), and the monocyte/macrophage marker rat anti-mouse F4/80 (1:100, Serotec, Oxford UK). Primary antibodies were visualized using appropriately tritrated Alexa Fluor-conjugated secondary antibodies (1:1000, goat anti-rabbit for CD36 and VEGF-A, goat anti-rat for F4/80). Negative control experiments were conducted in parallel by incubating sections with PBS-GEN alone followed by the secondary antibodies. Sections were visualized by epifluorescence microscopy.
Isoprostane Measurements
Isoprostanes (8-Iso-PGF2
) were measured in homogenized normal (n = 10) and 4-day postinjury corneas (n = 10) by enzyme immunoassay (Cayman Chemical, Inc.), as previously described.34 The levels of 8-isoprostane were quantified and normalized to the protein content of the corneal tissue.
Statistical Analysis
Results are expressed as the mean ± SEM. Statistical analyses were performed by using ANOVA with comparison among means performed by the appropriate post hoc test, unless otherwise stated. Statistical significance was set at P < 0.05.
| Results |
|---|
|
|
|---|
|
|
|
Effect of Oxidized Phospholipids on CNV and Existing Microvessels in an Aortic Ring Angiogenesis Assay
To ascertain whether the effects of POVPC are CD36-dependent, we used the mouse aortic ring angiogenesis assay. Aortic rings were treated on day 3 with saline, POVPC (20 µg/mL), or a combined treatment of POVPC and JC61.3 (6 µg/mL), or FA6-152 (10 µg/mL). POVPC inhibited neovessel formation (P < 0.001; Fig. 4A ). This angiostatic effect of POVPC was blocked by the anti-oxLDL site antibody (P < 0.001). Effects of POVPC were hardly affected by the anti-TSP-1 site antibody. POVPC also induced regression of new vessels grown for 6 days (P < 0.0001; Fig. 4B ).
|
|
| Discussion |
|---|
|
|
|---|
In the pathophysiological setting of corneal injury, stimulation of CD36 seems largely mediated through its TSP-1 site (Fig. 2) , consistent with the already reported role of TSP-1 in CNV.16 However, CD36 can also be activated by several oxidized lipids and LDLs14 15 17 18 19 20 Numerous studies have identified oxidized phospholipids as high-affinity CD36 ligands,19 20 21 22 but we could not find increased levels of markers of oxidized lipids, namely isoprostanes, in injured corneas (Fig. 3) . On the other hand, activation of the CD36 receptor using an oxPL ligand (POVPC) significantly suppressed CNV, and this effect was prevented by a cognate antibody, confirming the specificity of POVPC for CD36 (Fig. 3) .19 20 21 22 In vivo effects were corroborated using the ex vivo aortic ring angiogenesis assay. Collectively, our results, together with those reported on TSP-1,16 provide conclusive in vivo and ex vivo evidence of the efficacy of CD36 as a major target in CNV.
Our in vivo observations after corneal injury pointed to expression of CD36 in macrophages (Fig. 1D) . Macrophages play an important role in angiogenesis,11 12 in that their selective depletion markedly limits pathologic neovascularization.12 37 Macrophages are also a significant source of VEGF-A (Fig. 5A) as reported,38 40 and abundant evidence points to a dominant role for VEGF in inflammation-induced CNV.9 10 37 VEGF also amplifies inflammatory CNV by further recruiting macrophages/monocytes.37 We therefore determined whether CD36 could modulate VEGF expression in the injured cornea and found that stimulation of CD36 with POVPC diminished VEGF-A expression, whereas blocking CD36 expression with FA6-152 substantially induced VEGF-A mRNA levels (Fig. 5) . This is consistent with recently documented effects of another CD36 ligand, TSP-1.41
The mechanisms of action of angiogenesis inhibitors have been a subject of considerable attention. The prevailing mode of action of CD36 in inhibition of angiogenesis is believed to be through sequential activation of p59fyn, caspase-3-like proteases, and p38 MAPKs, by targeting newly formed endothelial cells.15 29 42 In an attempt to explore the signaling pathway on binding of the anti-TSP1 CD36 mAb, we evaluated the expression of the stress-activated MAPK, JNK-1, which was found to be significantly induced in FA6-152treated corneas. This finding is corroborated by a study reporting an activation of the p38 and p42/44 MAPKs in an inflammatory model of CNV.43 We propose that the induction of JNK-1 may be attributed to the upregulation of VEGF-A observed after CD36 blockade. Consistent with this hypothesis, there has been a report that VEGF stimulates MAPK activity in various settings.43 Other signaling mediators such as the Sonic hedgehog (Shh) pathway, whose inhibition was recently reported to reduce ocular neovascularization,44 were not activated in our model nor were they implicated in the antiangiogenic effects of CD36 (data not shown). Of noteworthy mention, it may have been interesting to investigate whether the CLESH-containing protein, histidine rich glycoprotein (HRGP), modulates CD36 interactions in our studies, seeing that HRGP has been shown to abrogate the CD36-dependent signaling of TSP-1.45 Taken together, antiangiogenic effects of CD36 are mediated, not only through a direct effect on microvessels (Fig. 4) but also apparently by inhibiting macrophage-derived VEGF-A expression (Fig. 5) .
Current therapies for CNV, such as thermal laser or photodynamic therapy, induce only temporary closure of blood vessels,46 whereas a clinically more important aspect of CNV therapy is regression of established blood vessels. In the present study, we investigated this limitation by delaying POVPC treatments until 10 days after corneal injury and observed a significant reduction in existing CNV (Fig. 3B) ; a similar effect was observed ex vivo on aortic ring explants (Fig. 4B) . Therefore, activating CD36 not only suppressed but also induced regression of blood vessels. The mechanisms of blood vessel regression are not fully characterized. Nonetheless, certain inferences can be made based on available evidence. For instance, it has been proposed that in the ovary, blood vessel regression involves endothelial cell detachment and blood vessel occlusion.47 Pericyte loss also determines the susceptibility of vessels to regression.48 Likewise, increased levels of angiopoietin-2, along with a downregulation of VEGF can destabilize mature capillaries and induce their regression.49 These mechanisms may operate in response to CD36 stimulation.
Taken together, the current findings provide the first demonstration of the protective involvement of CD36 in limiting inflammatory CNV. Other antiangiogenic factors such as endostatin, thrombospondin, PEDF, and maspin have been found in the uninjured cornea, reaffirming the importance of these types of factors in maintaining transparency of the healthy cornea.2 3 50 Our observations have significant implications for the treatment of ocular neovascularization, in that CD36 stimulants would be effective not only in patients with ongoing CNV, but also in those with established CNV. Findings may not only apply to corneal inflammation after injury or infection, but may also be relevant in corneal graft failure which involves an inflammatory immune rejection. Finally, stimulation of CD36 with simple agonists such as oxPLs may provide insights into inexpensive therapies for CNV secondary to commonly encountered infections (such as trachoma) in developing countries.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by grants from the Hospital for Sick Children, Fight for Sight Foundation, and the Canadian Institutes of Health Research. BRM is a recipient of a studentship from the Foundation Fighting Blindness, Canada. SC and PH are recipients, respectively, of a Canada Research Chair and scholarship from the Fonds de la Recherche en Santé du Québec.
Submitted for publication December 28, 2005; revised May 15, 2006; accepted August 18, 2006.
Disclosure: B.R. Mwaikambo, None; F. Sennlaub, None; H. Ong, None; S. Chemtob, None; P. Hardy, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: Pierre Hardy, Research Center, Ste. Justine Hospital, 3175 Côte-Sainte-Catherine, Room 2714, Montreal QC H3T 1C5, Canada; pierre.hardy{at}recherche-ste-justine.qc.ca.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. Al-Mahmood, S. Colin, N. Farhat, E. Thorin, C. Steverlynck, and S. Chemtob Potent in Vivo Antiangiogenic Effects of GS-101 (5'-TATCCGGAGGGCTCGCCATGCTGCT-3'), an Antisense Oligonucleotide Preventing the Expression of Insulin Receptor Substrate-1 J. Pharmacol. Exp. Ther., May 1, 2009; 329(2): 496 - 504. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, J. Gao, W. Dai, and L. Lu Activation of Polo-like Kinase 3 by Hypoxic Stresses J. Biol. Chem., September 19, 2008; 283(38): 25928 - 25935. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Seth, J. Cui, E. To, M. Kwee, and J. Matsubara Complement-Associated Deposits in the Human Retina Invest. Ophthalmol. Vis. Sci., February 1, 2008; 49(2): 743 - 750. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Yang, B. R. Mwaikambo, T. Zhu, C. Gagnon, J. Lafleur, S. Seshadri, P. Lachapelle, J.-C. Lavoie, S. Chemtob, and P. Hardy Lymphocytic microparticles inhibit angiogenesis by stimulating oxidative stress and negatively regulating VEGF-induced pathways Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2008; 294(2): R467 - R476. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Collot-Teixeira, J. Martin, C. McDermott-Roe, R. Poston, and J. L. McGregor CD36 and macrophages in atherosclerosis Cardiovasc Res, August 1, 2007; 75(3): 468 - 477. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |