IOVS News in Physiological Sciences
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2006;47:4558-4568.)
© 2006 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.06-0353

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Figure
Right arrow An erratum has been published
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vasireddy, V.
Right arrow Articles by Ayyagari, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vasireddy, V.
Right arrow Articles by Ayyagari, R.

Elovl4 5-bp–Deletion Knock-in Mice Develop Progressive Photoreceptor Degeneration

Vidyullatha Vasireddy,1 Monica M. Jablonski,2 Md Nawajes A. Mandal,1 Dorit Raz-Prag,3,4 Xiaofei F. Wang,2 Lesli Nizol,1 Alessandro Iannaccone,2 David C. Musch,1 Ronald A. Bush,3,4 Norman Salem, Jr,5 Paul A. Sieving,3,4 and Radha Ayyagari1

1From the Ophthalmology and Visual Sciences, W. K. Kellogg Eye Center, University of Michigan, Ann Arbor, Michigan; the 2Ophthalmology, Hamilton Eye Institute, University of Tennessee, Memphis, Tennessee; the 3National Institute on Deafness and Other Communication Disorders (NIDCD) and the 4National Eye Institute (NEI), Bethesda, Maryland; and the 5Laboratory of Membrane Biochemistry and Biophysics, National Institute on Alcohol Abuse and Alcoholism (NIAAA), Rockville, Maryland.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. To develop and characterize a heterozygous knock-in mouse model carrying the 5-bp deletion in Elovl4 (E_mut+/–) and to study the pathology underlying Stargardt-like macular degeneration (STGD3).

METHODS. E_mut+/– mice were generated by targeting a 5-bp deletion (AACTT) in the Elovl4 gene by homologous recombination. E_mut+/– mice of age 2 to 18 months and age-matched wild-type (Wt) littermate control animals were analyzed for the expression of Elovl4 transcript, ELOVL4 protein, photoreceptor-specific genes, and retinal fatty acid composition. Functional retinal changes were evaluated by electroretinography (ERG) and by morphologic and ultrastructural criteria.

RESULTS. E_mut+/– mice retinas showed the presence of both Wt and mutant Elovl4 transcripts and proteins. Morphologic evaluation revealed cone photoreceptor ultrastructural abnormalities as early as 2 months of age, accumulation of lipofuscin in retinal pigment epithelium (RPE), and subretinal deposits at later ages. Shortening of rod outer segments (OS) was observed at ~10 months of age. Both cone and rod changes progressed with age. Unlike rod-specific genes, expression of selected cone specific genes was significantly reduced by 7 months of age. Mixed rod–cone and light-adapted b-waves were higher than normal at both 8 and 15 months. Levels of the fatty acids 20:5 (P = 0.027), 22:5 (P = 0.040) and 24:6 (P = 0.005) were found to be significantly lower in the retinas of E_mut+/– mice than in retinas of control subjects.

CONCLUSIONS. E_mut+/– animals display characteristic features associated with Stargardt-like macular degeneration and serve as a model for the study of the mechanism underlying STGD3.


Mutations in the gene elongation of very long-chain fatty acids-4 (ELOVL4) are implicated in human autosomal dominant Stargardt-like macular degeneration (STGD3), which is characterized by progressive loss of central vision, accumulation of retinal flecks, and window defects in the macula. The age of onset of STGD3 is typically the teenage years, and the disease is progressive.1 2

ELOVL4 is homologous to the ELO group of mammalian and yeast enzymes involved in the fatty acid chain elongation system.3 Like other ELO family members, the ELOVL4 protein contains a distinct iron binding motif, a histidine cluster (HXXHH), and an endoplasmic reticulum (ER) retention signal at its C-terminal end (KXKXX). The highest amount of Elovl4 expression is detected in the retina, and low levels of this transcript were also detected in brain, skin, lens, and testes.4 5 In retinal tissue, the protein is localized to the ER of the photoreceptor cells.6 All the mutations detected so far in this gene result in premature truncation of the protein and consequent loss of ER retention signal.4 7 8 Heterologous expression of mutant ELOVL4 in COS-7 cells demonstrated that the mutant proteins were misrouted and that they recruit the wild-type protein in the formation of aggresomes, a finding most likely consistent with a dominant negative effect.6 9

To assess the in vivo consequences of the 5-bp–deletion mutation (AACTT), we generated a heterozygous knock-in (KI) mouse model bearing the mutation in the Elovl4 gene (E_mut+/–) associated with human STGD3.2 10 In addition to carrying one copy each of the mutant and wild-type Elovl4 alleles, the expression of Elovl4 in these mice is controlled by the native promoter. Herein, we report our observations on the ocular phenotype of the E_mut+/– mice. We examined the eyes of these mice for photoreceptor degeneration, retinal pigment epithelial (RPE) changes, accumulation of lipofuscin, expression of photoreceptor-specific genes, electrophysiological response of the retina, and composition of total retinal fatty acids. The mice with a genotype homologous to STGD3 patients showed predominant cone photoreceptor degeneration closely mimicking the features observed in patients with STGD3. Therefore, these mice can serve as a unique and biologically relevant model for the study of the pathologic consequences of the Elovl4 5-bp–deletion mutation.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Reagents and Antibodies Used for the Study
Antibodies used in the study were as follows: anti-ELOVL4 antibody (1:500 dilution; Abcam, Cambridge, MA,); polyclonal anti-ELOVL4 affinity-purified antibody (1:50 dilution, which is described elsewhere4 ); monoclonal anti-PDI antibody (1:5 dilution; Calbiochem, La Jolla, CA), anti-ß-actin antibody (1:500 dilution; Sigma-Aldrich, St. Louis, MO), anti-S-opsin antibody (1:200 dilution; Chemicon, Temecula, CA), anti-M- opsin antibody (1:200 dilution; Chemicon); anti-rabbit Alexa Fluor 555 (1:2500 dilution), anti-mouse Alexa Fluor 488 (1:400 dilution), and anti-rabbit Alexa Fluor 594 (1:400 dilution; all from Invitrogen-Molecular Probes, Carlsbad, CA).

For RT-PCR, a DNA synthesis system (Super Script First-Strand; Invitrogen) was used. For fatty acid transesterification, 14% (wt/vol) BF3 was prepared in methanol.

Construct Design and Development of Heterozygous Elovl4 5-bp Deletion Mutant Knock-in Mice
To construct a targeting vector, an 11.5-kb mouse genomic DNA fragment containing exons 3 to 6 of Elovl4 was cloned from the 129/SV EV BAC genomic library. This fragment contains the sequence between 280 bp upstream of exon 3 and 1.4 kb downstream of exon 6. The 5-bp deletion–mutation in exon 6 was generated on the long arm using site-directed mutagenesis. A selectable cassette containing the Neomycin-resistant gene [Neo], flanked by two lox p sites was inserted into the KpnI site (Fig. 1) . The targeting vector was confirmed by restriction digestion and sequencing, using the forward (TGCGAGGCCAGAGGCCAGTTGTGTAGC) and reverse (ATGTGTCA GTTTCAT AGCCTGAAG) primers which can read the Neo gene cassette.


Figure 1
View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 1. Schematic depiction of the E_mut+/– targeting strategy. (A) Wild-type Elovl4 allele, with restriction enzyme sites (B, BamHI; E, EcoRI; R, EcoRV) and location of exons (boxes). The restriction sites were used to analyze the recombinants (data not shown). (B) The targeting vector, generated on the long arm of Elovl4 with a 5 bp-deletion (AACTT) and a Neo gene cassette flanked by loxP sites. (C) The Neo gene cassette with the 5-bp–deletion mutation were introduced in exon 6. N7 and N1 are the forward and reverse primer sequences designed to read from the selection cassette into the short arm (N1) and the long arm (N7). Forward (F) and reverse (R) primers were used to confirm the homologous recombination.

 
The targeting vector was linearized by NotI, and electroporated into 129/SV EV embryonic stem (ES) cells, and subjected to selection with G418 antibiotic and ganciclovir. PCR and Southern blot analyses were used to identify recombinant clones. Correctly targeted ES cells were injected into C57BL/6J blastocysts and implanted into pseudopregnant mice, to generate chimeras. These chimeras were mated with C57BL/6J mice to transmit the targeting allele. Mice carrying the 5-bp deletion were identified by amplification of the tail DNA followed by sequencing (Fig. 1) . The E_mut+/– mice were generated with assistance from Ingenious Targeting Laboratory, Inc. (Stony Brook, NY).

Animals
The mice were maintained according to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and with protocols approved by animal care and Use Committee of the National Institute of Health (NIH). All studies were performed using E_mut+/– mice and wild-type (Wt) littermate as control subjects. Animals were genotyped by amplification of mouse tail genomic DNA by testing for the presence of the 5-bp deletion, as reported earlier.10 Mice were maintained in a 12-hour dark–light cycle. All tissues used for analysis were collected from animals at the end of the dark cycle. E_mut+/– and Wt mice of ages 2 to 18 months were used to study histology; ultrastructure; electroretinogram (ERG); photoreceptor gene expression; and fatty acid analysis of the retina.

Electroretinograms
To evaluate retinal function, full-field ERGs were recorded from five 8-month-old E_mut+/– and six Wt control mice (all males) using a Ganzfeld stimulus. Subsequently, five E_mut+/– mice and five Wt mice from the same set of animals were used to record ERGs again at age 15 months. Mice were kept in the dark for 12 hours before dark-adapted responses were recorded. Light-adapted responses were recorded against a continuous background of 34 cd/m2. All mice were anesthetized, and ERGs were performed as described earlier.11 These same mice were used for morphology, immunohistochemical analysis, and determination of expression of ELOVL4 at 18 months of age.

Retinal Histology and Ultrastructure
For evaluation of retinal histology, eyes were collected after perfusion with a mixture of aldehyde consisting of 2% paraformaldehyde and 2% glutaraldehyde. Excised eyes were processed for histology and immunohistochemistry, as described earlier.4 12 Tissue sections were stained with toluidine blue and were viewed on a microscope (Eclipse E800; Nikon Inc., Tokyo, Japan), and the images were collected with image-processing software (MetaMorph; Universal Imaging Corporation, West Chester, PA).

For ultrastructural analyses, areas of interest that were identified at the light level were thin sectioned and collected on 200-mesh grids. Sections were viewed on an electron microscope (model 2000; JEOL Peabody, MA). Images were captured using image-capturing software (Advanced Microscopy Techniques, Danvers, MA).

Immunohistochemistry
For evaluation of cone survival and localization of ELOVL4, immunohistochemistry was performed using short (S)- and medium (M)-wavelength cone opsin–specific antibodies, anti-ELOVL4 antibody and anti-PDI (protein disulphide isomerase) antibody as described earlier.4 12 Sections were viewed under confocal microscope, and images were captured with the use of appropriate filters and lasers.

Expression of Elovl4 and Photoreceptor-Specific Genes in E_mut+/– Retinas
Total RNA was isolated from 2-, 4-, and 7-month-old animal retinas (RNeasy kit; Bio-Rad Laboratories, Hercules, CA) according to the manufacturer’s guidelines, and the reverse transcription reaction was performed (SuperScript-II; Invitrogen). The comparative Ct method was used to calculate the expression of total Elovl4, Wt, and mutant Elovl4 transcripts, and photoreceptor-specific gene expression in different samples of mouse retina, as described earlier.5 The primers used for the gene expression studies are listed in Table 1 .


View this table:
[in this window]
[in a new window]
 
TABLE 1. qRT PCR Primers Used for the Analysis of Photoreceptor Genes

 
Protein Isolation and Western Blot Analysis
Western blot analysis was performed as described earlier, with anti-ELOVL4 antibodies and anti-ß-actin antibodies.4 9 Levels of expression of ELOVL4 were compared by loading an equal amount of protein and measuring the intensity of immunopositive bands by densitometry.

Lipid Extraction and Fatty Acid Analysis
At the end of a 12-hour dark cycle, retinas were collected from 6-month-old E_mut+/– and Wt mice (n= 10 in each group). The retinas were weighed, and lipid extraction was performed according to the method of Bligh and Dyer.13 Butylated hydroxytoluene (BHT) was added to each sample, along with the internal standard 22:3 n-3 methyl ester. Retinas were subsequently transmethylated using the BF3-methanol method of Morrison and Smith14 as modified by Salem et al.,15 with the cosolvent hexane. The methyl ester samples were analyzed by gas chromatography, as previously described,15 except that the retinas were injected using a splitless method. For the splitless injection of 2 µL of the hexane extract, the purge flow to the split vent was at a rate of 14 mL/min and the valve opened 0.25 minute after injection.

Statistical Analysis
Data are presented as the mean ± SD. Comparisons of means between two experimental groups were performed using the two-tailed, independent Student’s t-test. Analysis of variance (ANOVA) was used for comparisons of means among more than two groups. Adjustments for multiple comparisons made use of stepdown testing methods.16 ERG data were analyzed with the Student’s t-test at each flash intensity, and with the Mixed procedure (SAS, Cary, NC) for comparison of the entire intensity curve between these groups.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Expression of the Elovl4 in E_mut+/– Mouse Retina
The KI mice carrying the 5-bp deletion in the heterozygous state were viable and fertile. At age 2 months, the presence of both Wt and mutant Elovl4 transcripts was detected in the retinas of E_mut+/– mice using primers specific to the Wt and mutant alleles by qRT-PCR (Fig. 2A) . Analysis of the 2-month-old retinal extract by Western blot also demonstrated the presence of both Wt (37kDa) and mutant proteins (33 kDa; Fig. 2B ). These observations indicate that both Wt and mutant Elovl4 transcripts and proteins are produced in the E_mut+/– mouse retinas.


Figure 2
View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 2. (A) Evaluation of expression levels of Elovl4 in E_mut+/ mice: Expression profile of Wt transcript (B) and mutant transcript (C) in E_mut+/– mice of 2 and 7 months age in comparison to the expression of Wt transcript in age-matched control retina (A) as determined by qRT-PCR. Both Wt and mutant transcripts were detected at 2 and 7 months of age, indicating the expression of Wt and mutant alleles. (B) Immunoblot analysis of ELOVL4 protein in E_mut+/– mice in comparison with the wild type. Total retinal lysates from E_mut+/– mice and the Wt were subjected to SDS-PAGE followed by Western blot analysis using anti-ELOVL4 antibodies. Bands corresponding to Wt and mutant ELOVL4 with expected molecular masses of 37 and 33 kDa, respectively, were observed in E_mut+/– mice, indicating the presence of Wt and mutant proteins.

 
Evaluation of Expression of Photoreceptor-Specific Genes in E_mut+/– Retina
Real-time quantitative RT- PCR analysis was used to measure the expression level of photoreceptor-specific genes: S-cone opsin (Opn1sw), M-cone opsin (Opn1mw), rhodopsin (Rho), RDS/peripherin, Rom1, Abca4, rod and cone transducin (Gnat1, Gnat2), rod and cone arrestin (Sag1, Arr3), and Elovl4, in E_mut+/– mouse retinas (Fig. 3) .


Figure 3
View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 3. Expression profile of photoreceptor-specific markers in E_mut+/– mouse retina. Quantitative expression of Elovl4, the cone-specific markers cone opsin (Opn1sw, Opn1mw), transducin (Gnat2), and cone arrestin (Arr3) and the rod-specific markers rhodopsin, transducin (Gnat1), and arrestin (Sag1) were determined by qRT-PCR (iQ SYBR Green Supermix and iCycler; Bio-Rad, Hercules, CA). A set of four housekeeping genes: hypoxanthine guanine phosphoribosyl transferase (Hgprt), ß-actin, ribosomal protein L (Rpl19), and succinate dehydrogenase (Sdha) were measured for normalization of the expression values. Expression of different genes are presented (Figure 3) as a percentage of the expression of the gene in Wt mice ({blacksquare}). Data calculated from at least three independent samples, each of which was analyzed at least in three replication reactions on an arbitrary scale. The results are presented as the mean ± SD.

 
In the retina of 2-month-old E_mut+/– animals, there was no significant change in the expression of either rod- or cone-specific genes or total Elovl4 (Wt and mutant alleles together) when compared with the expression in Wt mice (P > 0.05, data not shown). By 4 months, the expression of total Elovl4 was found to be decreased, but it was not significant (P = 0.207). There was a slight decrease in the expression of cone-specific markers such as Opnl-sw, Opnl-mw, and Arr3 in E_mut+/– mice when compared with Wt animals, but the difference in the levels of expression was not yet significant at that age (P > 0.1). There was no indication that levels of expression of other marker genes, Gnat2, Rho, Rom1, sag1, or Gnat1 were altered in E_mut+/– mice compared with Wt control mice (Fig. 3) .

By 7 months, the expression of total Elovl4 was found to be reduced to less than half in the E_mut+/– retina compared with Wt retina (P < 0.001, Fig. 3 ). A significant decrease (P = 0.043) in the expression of rod and cone expressed gene Abca4 was observed in the E_mut+/– retina, whereas the expression of Rds was unaltered. Cone-specific genes Opn1sw, Arr3, and Gnat2 showed significantly lower levels of expression in E_mut+/– (P < 0.010) retina compared with Wt, whereas the expression of Opn1-mw remained unaltered. At this age, also the rod-specific genes Rho and rod arrestin (Sag1) showed a significant decrease (P < 0.05) in their expression in the E_mut+/– retina, whereas rod transducin (Gnat1) appeared to be slightly reduced but not to a statistically significant extent (P = 0.1). Expression of Rom1 was found to be unaltered in E_mut+/– mice (Fig. 3) .

In summary, the expression of cone-specific genes was found to be altered in the early stages of degeneration, and in later stages the decrease in expression of cone-specific genes was found to be greater than the decrease in expression observed in rod-specific genes. Among the rod-specific genes tested, the expression of structural components of rod photoreceptors, such as Rds and Rom1 were not altered even in late-stage degeneration (7 months), whereas the genes Rho, Sag1, and Gnat1, that are involved in the visual cycle showed decreased levels of expression (Fig. 3) . In E_mut+/– mice, reduction in the expression of selected photoreceptor genes indicates either downregulation of these genes or loss of photoreceptors, predominantly S-opsin expressing cones.

ERG Findings
At 8 months of age, b- and a-wave amplitudes were consistently higher in dark- and light-adapted responses in E_mut+/– mice (Fig. 4) . This difference was statistically significant (P < 0.05) in dark-adapted responses at flash intensities to which both rods and cones contribute and at all flash intensities in the cone-driven, light-adapted ERG. When considering the set of all log b-wave amplitudes across all stimulus intensities in the dark-adapted responses (inclusion criteria: amplitude >15 µV), there was a significant difference between Wt and E_mut+/– mice (P = 0.004). The implicit time of the b-wave in the dark-adapted responses of the E_mut+/– mice was significantly delayed relative to the Wt (P = 0.05). The b-wave of the light-adapted responses was also slightly delayed in the E_mut+/– mice, though this difference was not statistically significant.


Figure 4
View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 4. Representative (A) dark- and (B) light-adapted responses of an E_mut+/– mice and a Wt control mouse at age 8 months. Intensity–response curves of (circles) b- and (squares) a-wave amplitudes of the (C) dark- and (D) light-adapted responses of E_mut+/– (n= 5, filled symbols) and Wt mice (n= 6, open symbols). Standard error bars are shown. *Significant amplitude differences between the groups (P < 0.05). Amplitudes are significantly different between the groups at all intensities in the light-adapted responses in (D) (inclusion criteria, >15 µV).

 
The ERG at 15 months showed similar results though amplitude differences between the groups were smaller. The b- and a-wave amplitudes again were consistently higher in mixed rod-cone dark adapted responses in the E_mut+/– mice; however, the differences were no longer statistically significant. The b-wave amplitudes were significantly higher in the E_mut+/– mice in cone-driven light-adapted responses (P < 0.05; Fig. 5 ).


Figure 5
View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 5. Representative (A) dark- and (B) light-adapted responses of an E_mut+/– and a Wt control mouse at 15 months. Intensity–response curves of (circles) b- and (squares) a-wave amplitudes of the (C) dark and (D) light-adapted responses of E_mut+/– (n= 5, filled symbols) and Wt (n= 5, open symbols) mice at 15 months. Standard error bars are shown. b-Wave amplitudes were significantly different between the groups at all intensities of the light adapted responses in (D) (inclusion criteria, >15 µV).

 
Retinal Structure and Evaluation of Photoreceptor Cell Loss
To assess the effect of the 5-bp deletion–mutation in Elovl4 on the retina, we performed several analyses to evaluate cellular structure (Fig. 6) and cytoarchitecture (Fig. 7) , along with an assessment of the number of cones (Fig. 8) and rods (Fig. 9) at various ages from 2 to 18 months. Light microscopic evaluation of retinal sections from 2- to 15-month-old E_mut+/– mice revealed progressive changes in the outer retina (Fig. 6) . Several abnormalities were present in the RPE of the E_mut+/– mice. For example, vacuoles were present in the RPE at all ages from 2 to 15 months (Figs. 6B 6C 6D 6E 6F 6G 7D) . A higher-magnification view of the vacuoles is shown in Figure 7D . Moreover, the thickness of the RPE was considerably greater in E_mut+/– mice at 2 months than in age-matched Wt control mice (compare Figs. 7D and 7A ), a finding that has been described in abcr/ mice.17 Numerous packets of phagocytized OS and irregularly shaped pigment granules were present throughout the cytoplasmic compartment of the RPE. Based on the criteria used by Mata et al.,17 the appearance of these granules is consistent with lipofuscin deposits. In addition, in E_mut+/– mice 8 months of age and older, there were expansive areas of debris in the subretinal space (Figs. 6D and 6G) . The subretinal debris comprises primarily RPE fragments and undigested outer segments (Fig. 6H) .


Figure 6
View larger version (201K):
[in this window]
[in a new window]
 
FIGURE 6. Light microscopic evaluation of the retina in wild-type (A) and E_mut+/– mice (BG) at various ages: (A) 2-month-old Wt mouse; (B) 2-month-old E_mut+/–mouse; (C) 4-month-old E_mut+/–mouse; (D, G) 8-month-old E_mut+/–mouse; (E) 10-month-old E_mut+/–mouse; and (F) 15-month-old E_mut+/–mouse. The retinal area illustrated in (D) is shown at lower magnification in (G) to demonstrate the extent of the subretinal debris. A similar area is shown at higher magnification in (H) and indicates that the debris is composed primarily of RPE fragments and undigested OS. Black arrows: disrupted cone OS; white arrows: vacuoles in the RPE (high-magnification image showing vacuoles, Supplementary Fig. S1, is available online at http://www.iovs.org/cgi/content/full/47/10/4558/DC1). Black asterisks indicate gaps in the OPL. Scale bar, 10 µm.

 

Figure 7
View larger version (119K):
[in this window]
[in a new window]
 
FIGURE 7. Electron microscopic evaluation of the retinas in Wt (AC) and E_mut+/– mice (DF) at 2 months. White arrows: undigested OS; black arrows: small, irregularly shaped dense bodies (lipofuscin); black asterisks: vacuoles within the RPE; black arrowhead: disrupted cone OS; white arrowhead: gaps surrounding rod spherules in OPL. High magnification image of (D) is available as Supplementary Fig. S1, online at http://www.iovs.org/cgi/content/full/47/10/4558/DC1. Scale bar, 2 µm.

 

Figure 8
View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 8. Analysis of the number of cone photoreceptors at various ages. Cone photoreceptors were analyzed from 4-, 6-, and 18-month-old E_mut+/– mice retinas immunolabeled with anti-S or -M opsin antibodies and compared with the Wt. (A) The number of S-opsin-containing cones at 4 (P = 0.065), 6 (P = 0.023), and 18 (P = 0.00) months. (B) The number of M-opsin-containing cones at 4 (P = 0.013), 6 (P = 0.062), and 18 (P = 0.472) months. ({blacksquare}) Wt; (Figure 8) E_mut+/–. Data are the mean ± SD.

 

Figure 9
View larger version (79K):
[in this window]
[in a new window]
 
FIGURE 9. Confocal immunohistochemical localization of ELOVL4 (red) and PDI (green) in retinas from Wt (A) and E_mut+/– (B) mice at 4 months. Blue: nuclei. (C) The average normalized integrated intensity values for the IS region and OPL region. The immunolabeling intensity in the IS (P = 0.015) and OPL (P = 0.003) was significantly higher in the E_mut+/– mice. (D) Western blot analysis of ELOVL4 protein and ß-actin in the retina of E_mut+/– mice in comparison to control retina. Scale bar, 10 µm.

 
As early as 2 months, structural abnormalities were present in the outer segments of some photoreceptors at the outer/inner segment (OS–IS) interface (Fig. 6B) . This localization along with the periodic spacing of the disrupted OS strongly suggested that these were the OS of cone photoreceptors. An example of a dysmorphic cone OS is seen more clearly at the electron microscopic level (Fig. 7E) . To assess the effect of the 5-bp deletion in Elovl4 specifically on cone photoreceptors, cryosections taken from the posterior pole of eyes obtained from E_mut+/– and Wt mice at various ages were immunostained with S- or M-opsin-specific antibodies. The number of immunopositive M- or S-cones per 250-µm field was determined in central and peripheral areas across each retinal section. There was a significant decrease in the number of cones expressing S opsin in E_mut+/– mice aged 6 months or older than in control animals (P = 0.023; Fig. 8A ). In contrast, no age-related decline in the number of cones expressing M opsin was found (P = 0.062; Fig. 8B ). At 18 months, the number of cones expressing S-opsin continued to decline compared with control mice (P < 0.001; Fig. 8A ). In contrast, the number of cones expressing M-opsin showed no difference in number when compared with control retinas.

Rod photoreceptor OS structure was normal at all ages. However, by 10 months, the length of rod OS and the thickness of the outer nuclear layer (ONL) appeared thin compared with that in younger mice. To determine whether the loss of rods was significant, we measured the length of OS and counted the number of cell layers in the outer nuclear layer. Although we found no difference compared with control subjects in either measure at 8 months (data not shown), at 10 months a significant difference in the ONL cell count in the far peripheral region was observed (P = 0.03), whereas there is no significant change in the mid periphery and central region. Rod outer segment length at the far periphery and mid periphery was found to be significantly shorter at 10 months of age when compared with that in control subjects (P = 0.012, 0.005), whereas no significant difference was found in the central region.

The final structural abnormality manifest in the eyes of E_mut+/– mice involved the outer plexiform layer (OPL). At the light microscopic level, the OPL contained gaps and was heterogeneously stained. At the electron microscopic level, there were areas surrounding the rod spherules that appeared to be empty and lacked the extracellular matrix present in the Wt control subjects (compare Figs. 7F and 7C ).

Our recent studies in which we evaluated the localization of ELOVL4 in COS-7 cells demonstrated that the presence of ELOVL4 with the 5-bp deletion caused mislocalization of the protein away from the endoplasmic reticulum.6 9 Similar observation was reported by Grayson and Molday.6 and us.9 To demonstrate whether a similar phenomenon occurred in the mouse retina, we evaluated the localization patterns of both the ELOVL4 protein and PDI, an ER marker. In the retina of 4-month-old Wt animals, ELOVL4 was localized in the expected location (Fig. 9A) . ELOVL4 was found in greatest abundance in the ER of photoreceptors along with a minor component in the photoreceptor inner segments outside of the ER, as observed previously. Minimal immunopositive labeling was found in the OPL, consistent with previously reported localization of ELOVL4 (Figs. 9A 9B) .4 6 9 With this anti-ELOVL4 antibody, directed toward the N terminus of the molecule, we also observed immunoreactivity in the inner nuclear layer (INL). This finding differs from the findings of Grayson and Molday,6 who used an antibody directed toward the C terminus of ELOVL4. This methodological difference probably accounts for the discrepancy in the pattern of immunoreactivity. In E_mut+/– mice of the same age, there were two striking differences in the localization pattern of ELOVL4 compared with that in control mice. First, the quantity of immunopositive labeling in the inner segments appeared to be much greater. Second, there appeared to be a substantially greater amount of ELOVL4 localized to the OPL. To verify these differences in ELOVL4 amount, we quantified the amount of signal captured with the ELOVL4-specific channel from the confocal microscope. To make the images directly comparable, all immunohistochemistry experiments were performed simultaneously and all images were taken on the same afternoon using identical microscope settings. Image intensity was determined with image-analysis software (MetaView; Update Software, Chevy Chase, MD) on areas of the same size over the inner segment and OPL regions. The integrated intensity values were normalized such that the values obtained from Wt retinas were set to 1.0. The amount of immunopositive label of both the inner segments (P = 0.015) and OPL (P = 0.003) were significantly greater in the E_mut+/– mice than in the Wt littermate control subjects. Consistent with these observations, semiquantitative Western blot analysis of ELOVL4 protein in the retinas of E_mut+/– and Wt mice also indicated a higher amount of total ELOVL4 protein in the E_mut+/– (Fig. 9D) . The anti-ELOVL4 antibodies used in these experiments recognize both the Wt and mutant proteins.

Retinal Fatty Acid Profile of Elovl4 5-bp–Deletion Mutant KI Mice
To determine the effect of the Elovl4 5-bp deletion–mutation on the retinal fatty acid composition, we analyzed the fatty acid composition of retinas of 6-month-old mice. In addition, the fatty acid composition of the whole eyeballs of pups on the day of birth (P0) with no fully formed photoreceptors was determined.

There were no significant differences in the composition of retinal fatty acids of 6-month-old E_mut+/–mice and Wt control subjects, with the exception of some of the n-3 fatty acids. A significant alteration in the levels of eicosapentaenoic acid (EPA), 20:5n-3 (P ≤ 0.028), docosapentaenoic acid (DPA), 22:5n-3 (P ≤ 0.04), and 24:6n-3 (P ≤ 0.005) was observed in the E_mut+/– retina compared with Wt retinas (Table 2) . A similar trend of alteration in long-chain fatty acids in the whole eyeballs was observed in P0 E_mut+/– pups when compared with the Wt (Table 3) . There is a significant alteration in the levels of 20:0 (P = 0.01), 20:1 n-9 (0.038), EPA, 20:5n-3 (P = 0.006), DPA, 22:5n-3 (P < 0.001), 24:5 n-3 (P = 0.003), and 24:6 n-3 (P = 0.046) in the eyes of E_mut +/– P0 pups compared with that of the fatty acid composition of control animals. The observed changes in long-chain fatty acid content in adult and P0 pups indicates the possible involvement of Elovl4 in long-chain fatty acid metabolism.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Fatty Acid Profiles of Retinas from E_mut+/– and Wild-Type Mice at 6 Months

 

View this table:
[in this window]
[in a new window]
 
TABLE 3. Fatty Acid Profiles of Eyeballs from E_mut+/– and Wild-Type Mice at P0

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we developed a KI mouse model containing an Elovl4 5-bp deletion–mutation, shown previously to be associated with human dominant Stargardt-like macular dystrophy (STGD3). The genotype of heterozygous KI (E_mut+/–) mice resembles humans affected with STGD3, as they express both Wt and mutant Elovl4 alleles. In these mice, cone photoreceptor degeneration was evident from age 2 months, progressing to significant cone photoreceptor loss by 6 months, with a further decrease by 18 months. This effect was stronger on S- than M-cones. Rod photoreceptor loss was not evident until 10 months. There was significant loss of both photoreceptor nuclei and outer segment length after this time. Substantial RPE changes are evident as early as 2 months including undigested OS packets, lipofuscin, vacuoles, and deposits of pigmented debris in the subretinal space. These observations are consistent with the pathology observed in STGD3 patients including primary RPE atrophy, loss of central vision with visual acuities ranging from 20/20 to 20/300, and worsening of color vision with acuity loss.1 2 18 These changes have been found to be progressive over three or four decades in STGD3 patients. Loss of photoreceptors and accumulation of lipofuscin were also described in Elovl4 5-bp–deletion transgenic mice with two to eight copies of the transgene.19 The morphologic changes described in the transgenic mice appear to be more severe than in our KI animals, but these models have not been compared directly. The severity of retinal degeneration in the Elovl4 5-bp deletion transgenic mice could be because of the multiple copy number of the transgene, the site of insertion of the transgene and also the presence of the two copies of the Wt alleles that remain in the background in addition to the transgene.

The structural aberrations observed in the photoreceptor of E-mut+/– mice suggest retinal disease by age 2 months. Accumulation of a large amount of undigested OS material within the RPE and debris in the subretinal space of these mice indicates impaired digestion of phagocytized OS. Impairment of the RPE function itself is likely to be involved in photoreceptor cell loss that is commonly observed in macular degeneration.20 21 22

The ERG response is the sum of all retinal potentials and comprises negative and positive components. Increased amplitudes in a diseased retina may therefore result from elimination of an underlying negative-going component. For example, ERG responses increase after administration of tetrodotoxin (TTX) to remove spiking activity originating in the proximal retina.11 23 It is therefore possible that a suppression of a proximal retinal component of cone pathway function contributes to the increased response amplitudes. However, elimination of a component is usually accompanied by altered waveforms, as was seen when TTX is administered, whereas the ERG responses of the E_mut+/– mice had normal waveforms.

Generally, in partial death of the photoreceptor population ERG amplitudes decrease; only a few studies report the opposite. One study reported slightly increased L-cone–driven ERG responses in a patient with autosomal recessive Stargardt macular dystrophy-fundus flavimaculatus24 associated with mutations in the ABCA4 gene. Other instances of supernormal cone function were reported in the rhodopsin knockout mouse, as well as in a transgenic pig model of retinal degeneration (P347L rhodopsin mutation) where they were attributed to an abnormal retinal development.25 26 In theory ERG amplitudes could also increase if resistivity of the RPE increases,27 as might occur with diffuse accumulation of lipofuscin. A plausible finding to explain the persistently supernormal ERG amplitudes could be the mislocalization of ELOVL4 immunoreactivity to the OPL, where its presence may have induced, via an as yet to be determined mechanism, an increase in the photoreceptor-to-bipolar cell synapse.

The fatty acid analysis showed significantly altered levels of long-chain n-3 fatty acids not only in the retina of 6-month-old animals but also in the eyeballs of P0 pups with no significant photoreceptors. The altered levels of fatty acids in the 6-month-old E_mut+/– animal retina could be due simply to the photoreceptor cell loss, but the alteration in the n-3 levels of P0 pups with no photoreceptors may indicate a more definite role for ELOVL4 in n-3 fatty acid metabolism and the influence of the presence of the 5-bp deletion–mutation on the n-3 fatty acid profile. The level of docosahexaenoic acid (DHA, 22:6 n-3), the major n-3 fatty acid present in the retina was not altered either in the retinal tissue of 6-month-old E_mut+/– mice or in the eyeballs of P0 pups, indicating that Elovl4 mutation may not directly affect the DHA metabolism. The diet of these animals contained somewhat higher amounts of DHA, EPA, and linolenic acid (1% DHA, 1% EPA, 20:5 n-3; 1% linolenic acid,18:3 n-3; and 20% linoleic acid, 18:2 n-6) compared with the mean amount in the American diet, and this may have masked some of the effects of the Elovl4 mutation. Dietary intake of DHA and EPA were suggested to effect favorably the severity of phenotype in STGD3.28 29 Additional studies are needed to evaluate the specific role of Elovl4 in fatty acid metabolism.

The levels of expression of Wt Elovl4 were found to be significantly lower in E_mut+/– animals than in control retinas. The retina of knock-out mice carrying the Elovl4 null allele in the heterozygous state did not develop significant photoreceptor degeneration by 16 months, suggesting that haploinsufficiency of Elovl4 may not cause photoreceptor degeneration.30 Therefore, the reduction in the levels of Elovl4 Wt allele alone may not be responsible for the photoreceptor degeneration observed in the E_mut+/– mice.

In control mice, expression of Elovl4 is evident from mouse embryonic day 7, suggesting that Elovl4 may play a role in normal development.5 In the E_mut+/– mice, the development of the retina was observed to be normal with no significant morphologic abnormalities until 2 months. This is very similar to what has been described in STGD3 patients in which retinal development appears to be normal, and no vision abnormalities are reported typically until the teenage years.1 2 Absence of developmental abnormalities in the retina of E_mut+/– mice and patients with STGD3 and later onset of retinal degeneration both in E_mut+/– mice and patients may indicate that the effect of mutant Elovl4 does not immediately follow the presence of mutant protein as such, but could be due to a secondary process that is induced by the presence of mutant ELOVL4 protein.

Morphology and gene expression profile of E_mut+/– mice indicated progressive photoreceptor cell loss, with significant cone cell degeneration, followed by loss of ROS length. In the retina of E_mut+/– mice accumulation of Elovl4 protein was observed in the photoreceptor and outer plexiform layers (Fig. 9) . In heterologous cultured cells expressing the wild-type and mutant ELOVL4 proteins, the mutant protein was found to interact with the Wt protein resulting in the accumulation of the Wt-mutant protein aggregates. Therefore, it is likely that the retinal degeneration observed in the E_mut+/– mice and in patients with STGD3 could be due to a dominant negative effect exerted by the mutant protein.

The mouse retina contains two types of cone pigments, short-wavelength (S)-sensitive and medium-wavelength (M)-sensitive.31 Unlike humans and other species, the majority of the cones in the mouse express both cone pigments. The M-cone opsin is expressed in every cone of the mouse retina, whereas the S-cone opsin is expressed in most of the cones.32 In E_mut+/– mice, we observed significant structural abnormalities in cone photoreceptors, primarily resulting in a decrease in the number of cones expressing both S-opsin protein and S-opsin mRNA (Fig. 8) . Although the specific type of photoreceptors that are affected in patients with STGD3 is not yet known, the loss of visual acuity and the worsening of color vision with visual acuity loss reported in these patients are consistent with the cone photoreceptor–associated changes observed in the E_mut+/– mice. Selective loss of cone photoreceptors has been reported in mice lacking the cone-specific gene CNGA3.33 Predominant cone photoreceptor abnormalities in E_mut+/– mice and ELOVL4-associated macular degeneration in humans suggest that cones are more susceptible to the damage caused by Elovl4 mutations than are rods.

These KI mice with cone photoreceptor degeneration preceding rod degeneration provide a valuable model for studying differential molecular pathways that operate in cone and rod photoreceptors and the mechanism underlying selective degeneration of macula and specifically to characterize the mechanism(s) underlying degeneration in STGD3.


    Acknowledgements
 
The authors thank Austra Liepa (University of Michigan) for generation, maintenance of the animals, and assistance in the preparation of manuscript; Mitchell Gillett (University of Michigan) and Kathy Troughton (University of Tennessee) for sectioning of histologic specimens; and Elisheva Reese (University of Tennessee) for assisting with immunohistochemistry.


    Footnotes
 
Supported by National Eye Institute Grant EY13198 (RA); The Foundation Fighting Blindness (RA); a research grant (RA) and an unrestricted grant to the Department of Ophthalmology, University of Tennessee (UTHSC) from Research to Prevent Blindness (RPB), Inc.; a National Eye Institute Core Grant to UTHSC (P30EY13080); the Herbert and Mary Shainberg Neuroscience Research Program (AI); an unrestricted grant from RPB to Ophthalmology at UTHSC, two National Eye Institute Core Grants to the University of Michigan, Department of Ophthalmology (P30EY007003) and Vision Research (P30EY07060); and the Intramural Research Program of the National Institutes of Health, NIAAA, NIDCD/NEI.

Submitted for publication March 30, 2006; revised May 16, 2006; accepted August 21, 2006.

Disclosure: V. Vasireddy, None; M.M. Jablonski, None; M.N.A. Mandal, None; D. Raz-Prag, None; X.F. Wang, None; N. Lesli, None; A. Iannaccone, None; D.C. Musch, None; R.A. Bush, None; N. Salem Jr, None; P.A. Sieving, None; R. Ayyagari, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Radha Ayyagari, Department of Ophthalmology and Visual Sciences, #325, W.K. Kellogg Eye Center, 1000 Wall Street, Ann Arbor, MI 48105; ayyagari{at}umich.edu.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Stone EM, Nichols BE, Kimura AE, Weingeist TA, Drack A, Sheffield VC. Clinical features of a Stargardt-like dominant progressive macular dystrophy with genetic linkage to chromosome 6q. Arch Ophthalmol. 1994;112:765–772.[Abstract/Free Full Text]
  2. Griesinger IB, Sieving PA, Ayyagari R. Autosomal dominant macular atrophy at 6q14 excludes CORD7 and MCDR1/PBCRA loci. Invest Ophthalmol Vis Sci. 2000;41:248–255.[Abstract/Free Full Text]
  3. Tvrdik P, Westerberg R, Silve S, et al. Role of a new mammalian gene family in the biosynthesis of very long chain fatty acids and sphingolipids. J Cell Biol. 2000;149:707–718.[Abstract/Free Full Text]
  4. Ambasudhan R, Wang X, Jablonski MM, et al. Atrophic macular degeneration mutations in ELOVL4 result in the intracellular misrouting of the protein. Genomics. 2004;83:615–625.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  5. Mandal MN, Ambasudhan R, Wong PW, Gage PJ, Sieving PA, Ayyagari R. Characterization of mouse orthologue of ELOVL4: genomic organization and spatial and temporal expression. Genomics. 2004;83:626–635.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  6. Grayson C, Molday RS. Dominant negative mechanism underlies autosomal dominant Stargardt-like macular dystrophy linked to mutations in ELOVL4. J Biol Chem. 2005;280:32521–32530.[Abstract/Free Full Text]
  7. Bernstein PS, Tammur J, Singh N, et al. Diverse macular dystrophy phenotype caused by a novel complex mutation in the ELOVL4 gene. Invest Ophthalmol Vis Sci. 2001;42:3331–3336.[Abstract/Free Full Text]
  8. Maugeri A, Meire F, Hoyng CB, et al. A novel mutation in the ELOVL4 gene causes autosomal dominant Stargardt-like macular dystrophy. Invest Ophthalmol Vis Sci. 2004;45:4263–4267.[Abstract/Free Full Text]
  9. Vasireddy V, Vijayasarathy C, Huang J, et al. Stargardt-like macular dystrophy protein ELOVL4 exerts a dominant negative effect by recruiting wild-type protein into aggresomes. Mol Vis. 2005;11:665–676.[Web of Science][Medline][Order article via Infotrieve]
  10. Zhang K, Kniazeva M, Han M, et al. A 5-bp deletion in ELOVL4 is associated with two related forms of autosomal dominant macular dystrophy. Nat Genet. 2001;27:89–93.[Web of Science][Medline][Order article via Infotrieve]
  11. Rangaswamy NV, Frishman LJ, Dorotheo EU, Schiffman JS, Bahrani HM, Tang RA. Photopic ERGs in patients with optic neuropathies: comparison with primate ERGs after pharmacologic blockade of inner retina. Invest Ophthalmol Vis Sci. 2004;45:3827–3837.[Abstract/Free Full Text]
  12. Jablonski MM, Dalke C, Wang X, et al. An ENU-induced mutation in Rs1h causes disruption of retinal structure and function. Mol Vis. 2005;11:569–581.[Web of Science][Medline][Order article via Infotrieve]
  13. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Physiol. 1959;37:911–917.
  14. Morrison WR, Smith LM. Preparation of fatty acid methyl esters and dimethylacetals from lipids with boron fluoride–methanol. J Lipid Res. 1964;53:600–608.
  15. Salem N, Jr, Reyzer M, Karanian J. Losses of arachidonic acid in rat liver after alcohol inhalation. Lipids. 1996;31(suppl)S153–S156.
  16. Holm S. A simple sequentially rejective Bonferroni test procedure. Scand J Stat. 1979;6:65–70.
  17. Mata NL, Tzekov RT, Liu X, Weng J, Birch DG, Travis GH. Delayed dark-adaptation and lipofuscin accumulation in abcr+/– mice: implications for involvement of ABCR in age-related macular degeneration. Invest Ophthalmol Vis Sci. 2001;42:1685–1690.[Abstract/Free Full Text]
  18. Lagali PS, MacDonald IM, Griesinger IB, Chambers ML, Ayyagari R, Wong PW. Autosomal dominant Stargardt-like macular dystrophy segregating in a large Canadian family. Can J Ophthalmol. 2000;35:315–324.[Web of Science][Medline][Order article via Infotrieve]
  19. Karan G, Lillo C, Yang Z, et al. Lipofuscin accumulation, abnormal electrophysiology, and photoreceptor degeneration in mutant ELOVL4 transgenic mice: a model for macular degeneration. Proc Natl Acad Sci USA. 2005;102:4164–4169.[Abstract/Free Full Text]
  20. Strauss O. The retinal pigment epithelium in visual function. Physiol Rev. 2005;85:845–881.[Abstract/Free Full Text]
  21. Duncan JL, LaVail MM, Yasumura D, et al. An RCS-like retinal dystrophy phenotype in mer knockout mice. Invest Ophthalmol Vis Sci. 2003;44:826–838.[Abstract/Free Full Text]
  22. Boulton M, Dayhaw-Barker P. The role of the retinal pigment epithelium: topographical variation and ageing changes. Eye. 2001;15:384–389.[Web of Science][Medline][Order article via Infotrieve]
  23. Bui BV, Fortune B. Ganglion cell contributions to the rat full-field electroretinogram. J Physiol. 2004;555:153–173.[Abstract/Free Full Text]
  24. Scholl HP, Kremers J, Vonthein R, White K, Weber BH. L- and M-cone-driven electroretinograms in Stargardt’s macular dystrophy-fundus flavimaculatus. Invest Ophthalmol Vis Sci. 2001;42:1380–1389.[Abstract/Free Full Text]
  25. Banin E, Cideciyan AV, Aleman TS, et al. Retinal rod photoreceptor-specific gene mutation perturbs cone pathway development. Neuron. 1999;23:549–557.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  26. Jaissle GB, May CA, Reinhard J, et al. Evaluation of the rhodopsin knockout mouse as a model of pure cone function. Invest Ophthalmol Vis Sci. 2001;42:506–513.[Abstract/Free Full Text]
  27. Rodieck RW. The Vertebrate Retina: Principles of Structure and Function. 1973; W. H. Freeman San Francisco.
  28. Hubbard AF, Askew EW, Singh N, Leppert M, Bernstein PS. Association of adipose and red blood cell lipids with severity of dominant Stargardt macular dystrophy (STGD3) secondary to an ELOVL4 mutation. Arch Ophthalmol. 2006;124:257–263.[Abstract/Free Full Text]
  29. MacDonald IM, Hebert M, Yau RJ, et al. Effect of docosahexaenoic acid supplementation on retinal function in a patient with autosomal dominant Stargardt-like retinal dystrophy. Br J Ophthalmol. Feb 2004;88:305–306.[Free Full Text]
  30. Dorit Raz-Prag RA, Avvagari R, Fariss RN, et al. Haploinsufficiency is not the key mechanism of pathogenesis in a heterozygous Elovl4 knockout mouse model of STGD3. . 2006;47:3603–3611.
  31. Szel A, Rohlich P, Caffe AR, van Veen T. Distribution of cone photoreceptors in the mammalian retina. Microsc Res Tech. 1996;35:445–462.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  32. Applebury ML, Antoch MP, Baxter LC, et al. The murine cone photoreceptor: a single cone type expresses both S and M opsins with retinal spatial patterning. Neuron. 2000;27:513–523.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  33. Biel M, Seeliger M, Pfeifer A, et al. Selective loss of cone function in mice lacking the cyclic nucleotide-gated channel CNG3. Proc Natl Acad Sci USA. 1999;96:7553–7557.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
IOVSHome page
G. B. Reddy, V. Vasireddy, M. N. A. Mandal, M. Tiruvalluru, X. F. Wang, M. M. Jablonski, G. Nappanveettil, and R. Ayyagari
A Novel Rat Model with Obesity-Associated Retinal Degeneration
Invest. Ophthalmol. Vis. Sci., July 1, 2009; 50(7): 3456 - 3463.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M.-P. Agbaga, R. S. Brush, M. N. A. Mandal, K. Henry, M. H. Elliott, and R. E. Anderson
Role of Stargardt-3 macular dystrophy protein (ELOVL4) in the biosynthesis of very long chain fatty acids
PNAS, September 2, 2008; 105(35): 12843 - 12848.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
V. Vasireddy, Y. Uchida, N. Salem Jr, S. Y. Kim, M. N. A. Mandal, G. B. Reddy, R. Bodepudi, N. L. Alderson, J. C. Brown, H. Hama, et al.
Loss of functional ELOVL4 depletes very long-chain fatty acids (>=C28) and the unique {omega}-O-acylceramides in skin leading to neonatal death
Hum. Mol. Genet., March 1, 2007; 16(5): 471 - 482.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Figure
Right arrow An erratum has been published
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vasireddy, V.
Right arrow Articles by Ayyagari, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vasireddy, V.
Right arrow Articles by Ayyagari, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS