|
|
||||||||
1From the Departments of Ophthalmology and 2Pharmacology and Biological Chemistry, Mt. Sinai School of Medicine, New York, New York.
| Abstract |
|---|
|
|
|---|
METHODS. mRNA and protein was extracted from the retina and brain of DBA/2 and C57/BL6 mice and subjected to RT-PCR and immunoblot analysis, respectively. In addition, eyes from the same mouse strains were subjected to immunohistochemistry with antibodies specific to complement component 1q (C1q). Eyes from monkeys with unilateral experimental glaucoma were also subjected to immunohistochemical analysis, as were eyes from human subjects with or without glaucoma.
RESULTS. C1q mRNA and C1q protein were found to be upregulated in the retina of glaucomatous DBA/2 mice. Upregulation of C1q preceded the time of extensive RGC death and increased with increasing age to 15 months in the retina, but not in the brain. No age-related C1q upregulation was detected in the reference mouse strain (C57BL/6), which develops significant nonglaucomatous RGC loss toward the end of the same time frame. C1q upregulation was also detected in laser-induced glaucomatous monkey eyes and in some (but not all) eyes of patients with glaucoma. C1q upregulation was localized to the Müller cells within the retina and in the area of the inner limiting membrane.
CONCLUSIONS. Complement expression is upregulated in the retina of two commonly used glaucoma models (in the DBA/2 mouse and the monkey) and in some human glaucomatous eyes. The timing of this upregulation suggests that complement activation plays a significant role in the pathogenesis of glaucoma.
C1q is part of the activation arm of complement. It is the first element in the classic complement activation pathway that starts on binding of C1q to the antigen, either directly or through an antibodyantigen complex. C1q then interacts with and activates several proteases (C1r, C1s, C2-C4) that amplify the original response and initiate opsonization, anaphylactic reactions that attract phagocytes, and that finally directly attack the cell membrane through the membrane attack complex (MAC). In addition, C1q appears to have other potential functions through cell-specific receptors.2 3
Tissues that are known to express C1q include the heart4 and brain.5 In the brain, C1q can be induced by kainic acid and decortication in rats.6 C1q also appears to be involved in the pathogenesis of scrapie, as disease development is delayed in mice without C1q.7 8 Increased neuronal C1q expression occurs in Alzheimers disease (AD), and thus the role of C1q in the pathogenesis of AD has been the subject of considerable investigation, as reported in recent reviews.9 10 Damaged neuronal processes show evidence of MAC activation,11 with concurrent increase in the expression of C1q12 that is not paralleled by increases in the protective C1 inhibitor,12 indicating a complement-mediated autotoxic reaction. It has been proposed that microglia that carry receptors to C1q could exacerbate the inflammatory response in the AD brain.13 In contrast, C1q can bind to amyloid plaques in AD, reducing amyloid ß-peptide (Aß) uptake and thus leading to extracellular accumulation of Aß.14
Recent reports15 16 have suggested that components of the complement activation arm including C1q are upregulated in the retina of animal models of glaucoma. This suggests that C1q may be associated with glaucomatous pathology in the retina and that this condition has features in common with other neurodegenerations. To characterize further the temporal and spatial distribution of this upregulation in the retina in relationship to glaucomatous RGC damage, we investigated C1q expression in DBA/2 mice, which undergo spontaneous development of a form of angle-closure glaucoma; in monkey eyes with experimental glaucoma; and in human eyes with glaucoma.
| Methods |
|---|
|
|
|---|
Mice were anesthetized with a mixture of ketamine, xylazine, and acepromazine (10.8, 1.2, and 54 mg/kg) before death. Blood was aspirated from the left ventricle. Mice were then perfused with a solution containing heparin (1,000 U/mL) in normal saline to remove the remaining blood from the vascular tree, and the eyes and brain were immediately removed. The retina was isolated and stored (RNAlater; Ambion, Austin, TX) at 20°C, as was the brain. Blood serum collected was also stored at 80°C after centrifugation at 1000 rpm for 5 minutes in the presence of a cocktail of protease inhibitors (Roche Diagnostics, Indianapolis, IN).
Mice used for immunohistochemistry were initially perfused with the same solution, to remove blood from the vascular tree, and then with 4% ice-cold paraformaldehyde in phosphate-buffered saline (PBS). Eyes were enucleated and further fixed in the same fixative for 24 to 72 hours before further processing.
Enucleated eyes from two adult female cynomolgus monkeys with unilateral experimental glaucoma for more than 5 years were studied. In these two animals, glaucoma had been induced by repeated diode laser photocoagulation of the midtrabecular meshwork in the right eye. Both experimental eyes had high IOP (range, 2540 mm Hg) and apparent optic nerve damage. The left (untreated) eye of each animal was used as the control. The animals had in the past participated in other experiments to evaluate ocular hypotensive agents, but had not received any topical or systemic medications for at least 4 weeks before death. The eyes were enucleated at the time of euthanasia and preserved in 10% formalin for at least 3 weeks before processing.
Archival material from patients having undergone enucleation for a variety of reasons was also studied. Eyes of patients without significant ocular history that were obtained after death served as the control. Specimens were included in the experimental group if the clinical history indicated the presence of glaucoma (any type) or if the histologic examination revealed the presence of typical glaucomatous optic neuropathy. Specimens were excluded if the clinical history or histologic analysis indicated the presence of vitreous hemorrhage or active inflammation. Specimens had been fixed by immersion in 10% buffered formalin at the time of enucleation and were embedded in paraffin. Clinical data of the human eye samples used are summarized in Table 1 . Because information on the specimens was obtained through pathology records (and not through the patients records), information on treatment and IOP control is not complete. All eyes in this category showed histologic evidence of advanced glaucomatous neuropathy.
|
Real-time PCR was performed using primers designed based on the sequence of mouse C1qb mRNA (GenBank NM_009777; http://www.ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD). The anticipated product size was 193 bp. Primer sequences were: CCAACGCGAACGAGAACTAT (forward) and GTGGTCACCTGGAAGGTGTT (reverse). To quantitate accurately the amount of C1q in the various samples and account for variations that may be introduced by variable efficiency of reverse transcription, the product of a housekeeping gene was also amplified from the same cDNA samples in separate reactions. The gene rps11 (Mus musculus similar to 40S ribosomal protein S11, GenBank XM_193290) encoding for a ribosomal protein, was used for this purpose. Primer sequences used for rps11 amplification were CGTGACGAAGATGAAGATGC (forward) and GCACATTGAATCGCACAGTC (reverse). The PCR amplification (SYBR Green; Applied Biosystems, Inc. [ABI], Foster City, CA) was performed at three cDNA dilutions (1, 10, and 100 ng) for each run, with each dilution in triplicate. Reactions were run at least twice for each mouse strain and age group, tissue, and cDNA level. Reactions were run on a sequence-detection system (Prism 7900HT; ABI), and results were analyzed (SDS 2.1 software; ABI). Normalized relative concentrations of C1q mRNA in the various age groups were compared with analysis of variance (ANOVA) and post hoc Fisher least-significant difference (LSD) testing.
Immunoblot Analysis
The nonaqueous phase from the extraction (TRIzol; Invitrogen-Gibco) was dialyzed through a 3500-Da membrane (Millipore, Bedford, MA) at 4°C for 48 hours in 0.1% SDS and then centrifuged at 10,000g for 10 minutes. The supernatant was stored at 80°C until used. After resuspension in a buffer containing 25 mM Tris (pH 1.7), 1.6% SDS, 8% glycerol, and 0.7 M ß-mercaptoethanol (ßME) samples were subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Proteins were then transferred to nitrocellulose membranes (HybondECL; GE Healthcare, Piscataway, NJ). Nonspecific binding was blocked with blocking buffer (SuperBlock; Pierce, Rockford, IL) in PBS. Membranes were then incubated with the primary antibodies (anti-C1q, A301 at 1:4000; Quidel, San Diego, CA) and anti-actin (sc1616 at 1:500; Santa Cruz Biotechnology, Santa Cruz, CA). Detection was performed with a horseradish peroxidase (HRP) chemiluminescence system (ECL; GE Healthcare). Luminescence was measured with an automated imager (model 440CF, digital imaging station; Eastman Kodak, Rochester, NY). Relative optical density of each band was measured using the Image Tool software package (University of Texas Health Science Center, San Antonio). The amount of C1q in each lane was normalized in relationship to the amount of the housekeeping protein (actin) in the same lane. Normalized concentration graphs were created (a minimum of five membranes analyzed per point). Normalized concentrations were compared by using ANOVA with post hoc Fisher LSD testing. Immunoblots of both individual animal tissues as well as tissues pooled from several animals (minimum pool from five eyes per lane) were performed to account for individual eye variability in the amount of RGC loss in the DBA/2 retina.17
Positive controls included purified human C1q protein (Quidel) and mouse blood and rat testis lysate (BD Biosciences, Franklin Lakes, NJ) for C1q and actin antibodies, respectively. Specificity of the C1q antibody for the intact protein was confirmed by elimination of staining with complete disulfide bond reduction of the molecule18 19 (data not shown) as well as lack of staining on omission of primary antibody.
Immunohistochemistry
Sections of the tissues (45 µm) were collected on positively charged slides (ESCO, Superfrost Plus Microscope Slides; Erie Scientific, Portsmouth, NH) and dried in an oven for 1 hour at 60°C. Sections were then deparaffinized in xylene and rehydrated in graded alcohols. The tissues were digested with proteinase K (0.03% in distilled water for 20 to 40 minutes). Testing of the human specimens under various digestion lengths was necessary because of the variable conditions of time to fixation, amount of fixation, and processing of this archival material. Sections were then rinsed three times for 3 minutes with PBS and incubated with the primary antibodies (anti-C1q 1:200; Quidel; anti-glutamine synthase 1:50, BD-Transduction Laboratories, Lexington, KY) for 2 hours at room temperature in a solution containing 1% BSA in PBS. They were then rinsed three times with PBS and treated with the appropriate Alexa-conjugated secondary antibody (1:400; Molecular Probes, Eugene, OR) for 20 minutes at room temperature. After the sections were rinsed, they were treated with 4',6'-diamino-2-phenylindole (DAPI; 5 µg/mL) and washed, and the slides were coverslipped and observed with a microscope (Axioscope; Carl Zeiss Meditec, Inc., Dublin, CA), with the appropriate excitation wavelengths and filters. Antibody specificity for the C1q antibody was verified by immunoblot analysis (data not shown), elimination of staining with the addition of excess antigen, and the absence of C1q staining in sections of C1q/ animals20 (kindly provided by Marina Botto, Rheumatology Section, Faculty of Medicine, Imperial College, London, UK). Negative controls were incubated without primary antibodies.
For human specimens in particular, staining was considered positive if it was present in at least part of the retina under any of the two digestion protocols (20 or 40 minutes).
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
The expression of C1q in the retina has not been investigated. C1q expression has been reported to be upregulated in primate glaucoma by microarray analysis, but this finding15 has not yet been confirmed at the protein expression level. In addition, expression of C1q and other components of the complement activation arm have been reported to be upregulated in the retina of ocular hypertensive rats.16 Our results indicate an increase in the amounts of C1q in the retina of DBA/2 animals, in which glaucoma develops as they age, compared with young animals of the same strain.
The increase in C1q expression in the retina of DBA/2 mice started at approximately 6 months of age, was significant at approximately 9 months, and continued to 15 months. This increase in C1q expression parallels the time course of RGC loss but precedes it by at least 1 month in the DBA/2J animals (Danias J, unpublished data). The absence of such an upregulation in the brain of the same animals at the same time points suggests that it is specific for the retina. In addition, the C1q increase did not appear to be directly related to aging, as C57 mice (a reference nonpathologic strain) did not show any changes in immunostaining, even at advanced ages.
The initial increase in C1q immunostaining appears to coincide with the increase in IOP in these animals.17 24 However, in contrast to the IOP, which returns to baseline after 12 months of age, C1q expression continues to increase up to at least 15 months.
DBA/2 mice have certain immunologic abnormalities that cause low-grade anterior uveitis between 4 and 7 months of age.25 Given the temporal characteristics of C1q upregulation, it is unlikely that it is a direct consequence of this anterior chamber inflammation. It also does not appear to be part of a generalized neuroinflammatory phenomenon as other central nervous system (CNS) tissues do not show this upregulation.
Taken together, our results indicate that upregulation in C1q expression may be triggered by a stress caused by increased IOP on the retina of DBA/2 mice, but that its continuation may be related to the processes associated with RGC death. It is significant to note that C1q staining in the retina appeared to increase dramatically at about the time that significant RGC death begins in the glaucomatous DBA/2 mouse10 to 12 months of age. In addition, the presence of significant variability of C1q amounts in DBA/2 retinas of 15-month-old animals paralleled the variability in the RGC loss seen at this age.17
The presence of increased immunostaining in the primate glaucomatous retina further supports the notion that C1q upregulation detected in murine glaucoma is relevant and may play a role in human disease. Human specimens from some patients with long-standing severe glaucoma also confirm the involvement of C1q in the pathophysiology of the disease; however, the results from experiments on archival material must be interpreted cautiously and further confirmed with experiments performed with more standardized processing. In addition, the specimens used for this study may not be representative of the full range of the disease. Most of the glaucomatous specimens came from women with end-stage glaucoma and were obtained at enucleation, whereas control specimens came mostly from men and were obtained at autopsy. This may account for the lack of cosegregation of C1q staining with the presence of glaucoma.
Localization of C1q staining by immunohistochemistry in both the mouse and primate eyes with glaucoma is intriguing. Expression of C1q in Müller cells (the glial cells that support and modulate the RGC environment) and possibly the retinal astrocytes that line the internal limiting membrane may be an adaptive mechanism used to remove apoptotic RGCs. Such a mechanism has been proposed for C1q expressing CNS neurons.3 An alternative explanation could be that retinal glial cell dysfunction caused by high IOP or other unknown factors leads to C1q upregulation. The locally present C1q then binds to the RGCs causing cell death.
It is interesting to note that the presence of increased neuronal C1q expression that occurs in Alzheimers disease is also thought to be pathogenic in that neurodegenerative disease. It is tempting to speculate that glaucoma and Alzheimers disease share another common mechanism that leads to neuronal death.
| Footnotes |
|---|
Submitted for publication June 28, 2005; revised November 8, 2005; accepted January 17, 2006.
Disclosure: K. Stasi, None; D. Nagel, None; X. Yang, None; R.-F. Wang, None; L. Ren, None; S.M. Podos, None; T. Mittag, None; J. Danias, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: John Danias, Department of Ophthalmology, Box 1183, Mt. Sinai School of Medicine, 1 Gustave L. Levy Place, New York, NY 10029; john.danias{at}mssm.edu.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. H. Kwon, J. H. Fingert, M. H. Kuehn, and W. L.M. Alward Primary Open-Angle Glaucoma N. Engl. J. Med., March 12, 2009; 360(11): 1113 - 1124. [Full Text] [PDF] |
||||
![]() |
G. Tezel and the Fourth ARVO/Pfizer Ophthalmics Research Instit The Role of Glia, Mitochondria, and the Immune System in Glaucoma Invest. Ophthalmol. Vis. Sci., March 1, 2009; 50(3): 1001 - 1012. [Full Text] [PDF] |
||||
![]() |
J. M. Skarie and B. A. Link The Primary open-angle glaucoma gene WDR36 functions in ribosomal RNA processing and interacts with the p53 stress-response pathway Hum. Mol. Genet., August 15, 2008; 17(16): 2474 - 2485. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Scholz, T. Buder, S. Seeber, E. Adamek, C.-M. Becker, and E. Lutjen-Drecoll Dependency of Intraocular Pressure Elevation and Glaucomatous Changes in DBA/2J and DBA/2J-Rj Mice Invest. Ophthalmol. Vis. Sci., February 1, 2008; 49(2): 613 - 621. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Tezel, X. Yang, C. Luo, Y. Peng, S. L. Sun, and D. Sun Mechanisms of Immune System Activation in Glaucoma: Oxidative Stress-Stimulated Antigen Presentation by the Retina and Optic Nerve Head Glia Invest. Ophthalmol. Vis. Sci., February 1, 2007; 48(2): 705 - 714. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Stasi, D. Nagel, X. Yang, L. Ren, T. Mittag, and J. Danias Ceruloplasmin Upregulation in Retina of Murine and Human Glaucomatous Eyes Invest. Ophthalmol. Vis. Sci., February 1, 2007; 48(2): 727 - 732. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |