IOVS AJP: Renal Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

(Investigative Ophthalmology and Visual Science. 2006;47:3004-3010.)
© 2006 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.06-0178
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xia, C.-h.
Right arrow Articles by Gong, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xia, C.-h.
Right arrow Articles by Gong, X.

Arginine 54 and Tyrosine 118 Residues of {alpha}A-Crystallin Are Crucial for Lens Formation and Transparency

Chun-hong Xia,1 Haiquan Liu,1 Bo Chang,2 Catherine Cheng,3 Debra Cheung,1 Meng Wang,1 Qingling Huang,4 Joseph Horwitz,4 and Xiaohua Gong1

1From the School of Optometry and Vision Science Program, University of California, Berkeley, Berkeley, California; 2The Jackson Laboratory, Bar Harbor, Maine; the 3UC Berkeley/UCSF Joint Bioengineering Graduate Program, University of California, Berkeley, Berkeley, California; and the 4Jules Stein Eye Institute, University of California, Los Angeles, Los Angeles, California.


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. To identify new mouse models for studying roles of {alpha}A-crystallin in vivo and to investigate why and how different mutations of the {alpha}A-crystallin gene lead to dominant or recessive cataracts.

METHODS. Using mouse genetic approaches and slit lamp screening, we identified two mouse cataractous mutant lines. Causative genes were mapped by a genome-wide linkage analysis. DNA sequencing verified missense mutations of {alpha}A-crystallin gene in both mutant lines. Histology, imaging of green fluorescent protein (GFP)–positive lenses, and protein 2-DE gel were used to determine the morphologic and biochemical properties of mutant lenses.

RESULTS. Two new {alpha}A-crystallin gene mutations were identified, {alpha}A-R54C ({alpha}A-Cys) and {alpha}A-Y118D, which cause recessive whole cataracts and dominant nuclear cataracts, respectively. In homozygous {alpha}A-Cys mutant mice, lens epithelial and fiber cells lost their characteristic cellular features and developed disrupted subcellular structures, such as actin filaments and mitochondria. The nuclear cataract caused by {alpha}A-Y118D mutation was associated with increased water-insoluble crystallins ({alpha}, ß, and {gamma} classes). These results suggest that the Arg54 residue in the N-terminal region is crucial for {alpha}A-crystallin to perform its roles in lens epithelial and fiber cells during development, whereas the Y118D mutation in the central {alpha}-crystallin domain impairs {alpha}A-crystallin’s ability to maintain the solubility of crystallin proteins in the lens.

CONCLUSIONS. This work demonstrates that different regions of {alpha}A-crystallin mediate distinct functions in vivo. These two mutant mouse lines provide useful animal models for further investigating the multiple roles of {alpha}A-crystallin in the lens.

The {alpha}-crystallins, consisting of the {alpha}A and {alpha}B subunits, are members of the small heat shock protein (sHSP) family.1 2 3 They are structural components contributing to a transparent lens, and they are hypothesized to act as molecular chaperones to maintain lens transparency by preventing abnormal protein aggregation.4

{alpha}A-crystallin is a 173-amino-acid polypeptide encoded by the CryaA gene on mouse chromosome 17 and human chromosome 21. A splicing isoform ({alpha}Ains) that contains additional 23-amino-acid residues between residues 63 and 64 of the {alpha}A-crystallin protein is also expressed in mice.5 {alpha}B-crystallin is a 175-amino-acid polypeptide encoded by the CryaB gene on mouse chromosome 9 and human chromosome 11. The {alpha}A and {alpha}B subunits share approximately 60% amino acid sequence identity and account for 20% to 30% of the lens total proteins.6 They exist as heteromers that can undergo subunit exchange.7 Due to the polydispersed size distribution of both native and recombinant {alpha}-crystallins, the crystallization of {alpha}-crystallin proteins has been unsuccessful so far. Neither the three-dimensional (3-D) structure of {alpha}-crystallin proteins nor the topology of subunit assembly is known. Based on the 3-D structures of other members of the sHSP family, {alpha}A-crystallin can be divided into three regions: a variable N-terminal region (residues 1-63), the central {alpha}-crystallin domain made of ß-strands (residues 64-139), and the extended C-terminal region (residues 140-173).4 8 9

Genetic studies have reported that mutations of {alpha}A- or {alpha}B-crystallins cause dominant or recessive cataracts in both humans and mice. In {alpha}A-crystallin, two human missense mutations ({alpha}A-R49C and {alpha}A-R116C) and one mouse missense mutation ({alpha}A-V124E) lead to the development of dominant nuclear cataracts,10 11 12 whereas one human nonsense mutation ({alpha}A-W9X) and two mouse mutations ({alpha}A-R54H in lop18 mice and {alpha}A–/– knockout) cause recessive cataracts.13 14 15 In {alpha}B-crystallin, a frame-shift mutation and a missense mutation ({alpha}B-R120G) cause dominant cataracts in humans.16 17 These genetic studies demonstrate the importance of {alpha}A and {alpha}B-crystallins in the lens, but they do not provide explanations for why different mutations of {alpha}A- or {alpha}B-crystallin genes lead to a variety of cataract phenotypes.

Previous studies of {alpha}A and {alpha}B knockouts (null mutations) have revealed that {alpha}B is dispensable, whereas {alpha}A is essential for lens formation and transparency in mice. The {alpha}A–/– knockout mice have microphthalmia and small lenses with nuclear cataracts. Light and transmission electron microscopy studies reveal the presence of inclusion bodies that contain {alpha}B-crystallins in {alpha}A–/– lenses.13 In contrast, {alpha}B–/– knockout mice have relatively normal lenses without cataracts.18 Moreover, double-knockout {alpha}A–/– {alpha}B–/– mice have abnormal fiber cells without lens sutures.19 Therefore, {alpha}A and {alpha}B are important for both lens formation and transparency, but the in vivo functions of {alpha}A- and {alpha}B-crystallins cannot be further investigated by using these knockout mice, because these proteins are no longer present in null mutant mice.

Here, we report our findings of two new {alpha}A-crystallin mutations, {alpha}A-R54C ({alpha}A-Cys) and {alpha}A-Y118D, which cause a severe recessive cataract and a dominant nuclear cataract, respectively. In our study, the {alpha}A-Cys mutation altered the properties of lens epithelial and fiber cells by disrupting intracellular structures, such as actin filaments and mitochondria, whereas the {alpha}A-Y118D mutation increased the level of water-insoluble crystallin proteins but maintained relatively normal lens histology. This work provides in vivo evidence for the multiple functions of {alpha}-crystallins during lens development. These two mouse lines provide important animal models for further investigating distinct functions of {alpha}A-crystallin mediated by its N-terminal domain and the central {alpha}-crystallin domain in vivo.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Mouse Mutations, Genomic Linkage Analysis, and Causative Gene Identification
Mouse care and breeding were performed according to an Animal Care and Use Committee (ACUC)–approved animal protocol (UC Berkeley) and the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The L1N mouse line was identified from a screen of ENU-mutagenized mice. Mouse pupils were dilated by a 1:1 mixture of 2.5% phenylephrine hydrochloride and 1% atropine sulfate, and lens clarity was examined by a slit lamp. Mouse breeding and genomic linkage analysis were performed as described previously.20 The L1N mutant mice, in the C57BL/6J (B6) strain background, were mated with wild-type C3H/HeN mice to produce affected G1 hybrid mice that were further crossed with wild-type C3H/HeN mice to produce second-generation (G2) mice. The G2 mice were phenotyped, and their genomic DNAs were used for a genome-wide linkage analysis. Based on the chromosomal location, causative gene candidates were identified from the mouse genome database (MGD) at the National Center for Biotechnology Information (NCBI) website.

The nm3365 mouse line was a spontaneous recessive mutation segregated from the FVB/N-Tg (Trp53R172L)4491Jmr/J mice. A male homozygous founder had microphthalmia with dense cataracts and was mated with a wild-type BALA/cJ female to produce G1 female mice. All G1 heterozygous mice had normal lenses without cataracts. The G1 females were then backcrossed with the male homozygous founder to produce G2 mice, half of which had cataracts that had developed by weaning age. Affected G2 mice were intercrossed to produce the nm3365 mouse colony.

Total lens RNAs were isolated from the lenses of homozygous mutant mice (TRIzol Reagent; Invitrogen Life Technologies, Gaithersburg, MD). Total RNA (2 µg) was used to generate cDNA with an RT-PCR kit (Superscript First-Strand Synthesis System; Invitrogen Life Technologies, Gaithersburg, MD). The coding region of {alpha}A-crystallin was amplified with DNA polymerase (Platinum Pfx; Invitrogen Life Technologies) and sequenced to detect mutations. A pair of primers, 5' TCCTGATCTGACTCACTGCC 3' and 5' AGGCAGACTCTTTGCTGTGG 3', was used for PCR amplification of the entire coding region of the {alpha}A-crystallin gene and for determining its DNA sequence. RT-PCR and sequencing analysis were performed on at least three different lens RNA samples from both L1N and nm3365 mutant mice, to confirm mutations in the {alpha}A-crystallin gene.

GFP Fluorescence Imaging of Lens Epithelial Cells
Both nm3365 and L1N mice were bred with GFP transgenic mice to generate GFP-positive mutant mice.21 The GFP-positive mice were screened by using a UV light. Fresh GFP-positive lenses were dissected from enucleated eyeballs and were immediately imaged for GFP-positive epithelial cells by confocal microscope (Leica, Deerfield, IL).

Lens Phenotypes and Morphologic Analysis
Freshly dissected lenses were imaged under a dissecting microscope (MZ16 Leica) with a digital camera. Thin sections were prepared for morphologic analysis by light and electron microscopy. Briefly, mouse eyeballs or lenses were immersed in a fixative solution containing 2.5% glutaraldehyde and 2% formaldehyde in 0.1 M cacodylate buffer (pH 7.2) for 5 days at room temperature, postfixed in 1% aqueous OsO4, stained en bloc with 2% aqueous uranyl acetate, and dehydrated through graded acetone. Samples were embedded in Epon 12-Araldyte 502 resin (Ted Pella, Redding, CA). The Sections (1 µm) were collected on glass slides and stained with toluidine blue for histologic imaging. Bright-field images were acquired with a light microscope (Axiovert 200; Carl Zeiss Meditec, Inc., Dublin, CA) with a digital camera. For TEM analysis, ultrathin sections (60 nm) were prepared and stained with Sato’s triple lead solution before examination under an electron microscope (JEM-1200EX II; JEOL, Tokyo, Japan).

Two-Dimensional Electrophoresis of Lens Proteins
Fresh lenses were dissected from eyeballs and quickly weighed, to determine their wet weight. These lenses were homogenized in a phosphate buffer (pH 7) and prepared for the soluble fractions and the insoluble pellets as a procedure described previously.22 Two-dimensional electrophoresis (2-DE) was performed (PROTE-AN-IEF Cell with 11-cm IPG strips [pH 3–10]; Bio-Rad, Hercules, CA), and 8% to 16% linear gradient precise gels were used for the 2-D analysis. The gels were stained with Coomassie blue.


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
Role of Two New {alpha}A-crystallin Mutations in Recessive or Dominant Cataracts
The nm3365 mouse line is a spontaneous recessive mutation. Heterozygous (nm3365/+) mutant mice had normal lenses, whereas homozygous (nm3365/nm3365) mutant mice had microphthalmia and very small lenses with whole cataracts (Fig. 1A) . The average lens wet weight of homozygous mice was 60% less than that of wild-type mice at weaning age, but it was difficult to obtain an accurate weight measurement for homozygous lenses due to their severe phenotype.


Figure 1
View larger version (58K):
[in this window]
[in a new window]
  		FIGURE 1. Both the nm3365 recessive and the L1N dominant mutations mapped to mouse chromosome 17 in the proximity of the CryaA ({alpha}A-crystallin) gene. (A) Lens photographs of the various mouse strains (as labeled) at the age of 3 weeks. (B) Linkage analysis of the nm3365 and L1N mutations. Left: 67 meioses (numbers listed in the bottom line) from a backcross between nm3365 and CAST/EiJ were phenotyped and genotyped. The columns represent haplotypes ({blacksquare}: nm3365 allele; {square}: CAST/EiJ allele). The mutation is linked to several markers on mouse chromosome 17. The genetic map shows that the nm3365 mutation is linked to the D17Mit175 marker at position 17.70 cM on chromosome 17. The CryaA locus is in the proximity of this marker. Right: 88 meioses (numbers listed in the bottom line) from a backcross between B6-L1N/+ and C3H/HeJ were phenotyped and genotyped. The columns represent haplotypes ({blacksquare}: L1N allele; {square}: C3H/HeJ allele). The L1N mutation and the D17Mit175 marker were tightly linked (0/88). Scale bar: (A) 1 mm.

 
The L1N mouse line was identified from ENU-mutagenized mice by slit-lamp examination. Homozygous (L1N/L1N) mutant mice showed much denser nuclear cataracts than heterozygous mutant (L1N/+) mice at weaning age (Fig. 1A) . The average wet weights of wild-type, heterozygous and homozygous mutant lenses of 3-week-old mice were 3.55 ± 0.07 (n = 8), 3.31 ± 0.22 (n = 9), and 2.87 ± 0.04 (n = 11) mg. Thus, heterozygous lenses weighed approximately 7% less than wild-type lenses, and homozygous lenses weighed approximately 19% less than wild-type lenses.

Genome wide linkage analyses mapped both mutations to the linkage marker D17Mit175, which is in the proximity of the CryaA ({alpha}A-crystallin) gene on chromosome 17 (Fig. 1B) . Because {alpha}A-crystallin mutations were linked to cataracts, we performed sequence analyses using cDNAs synthesized from homozygous nm3365 and homozygous L1N lens RNAs. DNA sequencing of nm3365 cDNA samples revealed a single nucleotide change (C-to-T) at position 160 in exon 1 of the CryaA gene, which resulted in the substitution of the arginine residue at codon 54 by a cysteine ({alpha}A-R54C; Fig. 2A ). Of interest, the nm3365 mutation occurred at the same Arg54 as the lop18 mutation, which is {alpha}A-R54H mutation due to a G-to-A change at position 161.14 Sequencing data revealed that L1N was also a missense mutation (T-to-G) of the CryaA gene that resulted in the replacement of the tyrosine residue at codon 118 by an aspartic acid ({alpha}A-Y118D; Fig. 2B ).


Figure 2
View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 2. DNA sequencing reveals an {alpha}A-Cys (R54C) point mutation in the nm3365 mutant mice and an {alpha}A-Y118D point mutation in the L1N mutant mice. (A) DNA sequencing shows a C-to-T change in the first nucleotide for codon 54, which results in the replacement of Arg54 by a cysteine ({alpha}A-Cys) in the nm3365 mutation. (B) A nucleotide T-to-G change causes the substitution of the Tyr118 by an aspartic acid ({alpha}A-Y118D) in the L1N mutation. (C) Schematic drawing shows both {alpha}A-Cys (nm3365) and {alpha}A-His (lop18) mutations are located in the N-terminal domain. Lop18 is another {alpha}A recessive mutation where Arg54 is substituted by a histidine as previously reported. The {alpha}A-Y118D mutation is located in the central {alpha}-crystallin domain of the {alpha}A-crystallin protein. The {alpha}Ains, an alternative splicing isoform in mice, has additional 23 amino acid residues.

 
Thus, we named the nm3365, lop18, and L1N mutations as {alpha}A-Cys, {alpha}A-His, and {alpha}A-Y118D, respectively. Both Arg54 and Tyr118 are conserved residues that are located either in the N-terminal domain or in the central {alpha}-crystallin domain of the {alpha}A-crystallin protein (Fig. 2C) .

Effect of the {alpha}A-Cys Mutation on Lens Epithelium and Fiber Cells
Histologic sections showed no obvious changes in lens epithelial and fiber cells of {alpha}A(Y118D/Y118D) lenses when compared with wild-type {alpha}A+/+ lenses at weaning age (Fig. 3A) . Although some intracellular vacuoles were observed in the epithelial cells of {alpha}A(Y118D/Y118D) lenses, similar vacuoles were also seen in the epithelial cells of wild-type lenses (data not shown). Thus, histologic data did not provide useful evidence to explain why or how the {alpha}A-Y118D mutation causes smaller lenses.


Figure 3
View larger version (71K):
[in this window]
[in a new window]
  		FIGURE 3. Normal epithelial cells are observed in {alpha}A(Y118D/Y118D) lenses, whereas aberrant epithelial cells and degenerated fiber cells appear in {alpha}A(Cys/Cys) lenses. (A) Toluidine blue–stained lens sections show normal lens fiber cells in the bow regions of lenses from 3-week-old mice. (B) Images of toluidine blue–stained lens sections of 2-day-old mice. In {alpha}A(Cys/Cys) lenses, anterior epithelial cells are either dissociated from or aggregated under-neath the lens capsule (arrows), and posterior degenerated fiber cells are elongated about half the distance to the anterior epithelium (arrowheads, leading edge of the fiber cells). A fluorescent image of phalloidin- and 4',6'-diamino-2-phenylindole (DAPI)-labeled {alpha}A(Cys/Cys) lens frozen sections further confirms that the anterior half of the lens is filled with liquid rather than fiber cells (right). White arrowhead: leading edge of fiber cells; small white arrow: epithelial cells. (C) GFP-fluorescent images of lens epithelial cells from freshly dissected lenses of 7-day-old GFP mice. Normal epithelial cells show a mosaic expression pattern of GFP-positive (green) and GFP-negative (black) cells in the {alpha}A+/+ lenses. The epithelial cells of {alpha}A(Y118D/Y118D) lenses are normal, whereas the epithelial cells of {alpha}A(Cys/Cys) lenses have irregular morphology and abnormal vesicle-like cellular structures (white arrows). Scale bars: (A, B, C) 50 µ.

 
In contrast, histologic sections of postnatal day 2 (P2) {alpha}A(Cys/Cys) lenses showed severely altered epithelial cells and degenerated fiber cells (Fig. 3B) . Anterior epithelial cells were either detached from or aggregated underneath the lens capsule, and posterior fiber cells were only partially elongated. A large lumen in the anterior half of the lens was confirmed by histology and phalloidin staining. These data suggest that aberrant growth of epithelial cells and insufficient elongation of fiber cells lead to the small size of {alpha}A(Cys/Cys) lenses (Fig. 1A) .

We also examined the abnormality of epithelial cells in fresh {alpha}A(Cys/Cys) lenses by using a transgenic mouse line expressing green fluorescent protein (GFP) under an actin promoter.21 A mosaic expression pattern of GFP-positive and GFP-negative lens epithelial cells was observed in enucleated lenses from this transgenic mouse line (Fig. 3C , left), which was similar to another GFP-transgenic mouse line.23 The mosaic GFP pattern allows direct observation of epithelial cell morphology in fresh, enucleated lenses. We have, therefore, generated both {alpha}A(Y118D/Y118D) and {alpha}A(Cys/Cys) mutant mice that contain the GFP transgene. Direct observation of the GFP-positive lens epithelial cells further confirmed that epithelial cells in {alpha}A(Y118D/Y118D) lenses had normal morphology, but epithelial cells in {alpha}A(Cys/Cys) lenses were severely altered (Fig. 3C , middle, right). Irregularly shaped cells and vesicle-like cellular structures were observed in the epithelial layer of {alpha}A(Cys/Cys) lenses. Thus, the characteristic features of lens epithelium as a polarized monolayer of cuboidal epithelial cells were disrupted in {alpha}A(Cys/Cys) lenses.

These results suggest that {alpha}A-Cys mutant proteins probably interrupt some basic subcellular structures to alter characteristic properties of both epithelial cells and fiber cells during early lens development, whereas {alpha}A-Y118D mutant proteins probably perturb lens growth and transparency.

Interrupted Actin Filaments and Degenerated Mitochondria in {alpha}A(Cys/Cys) Embryonic Lenses
Actin filaments are necessary for maintaining epithelial cell polarity, cell shape, cell migration, and other cellular events. Actin filament assembly is also suggested to be regulated or protected by {alpha}-crystallins. Frozen sections of {alpha}A(Cys/Cys) embryonic lenses at different stages were stained by fluorescent-labeled phalloidin. Severely disrupted actin filaments were observed in the contact regions between anterior epithelial cells and posterior fiber cells of embryonic day 16.5 (E16.5) {alpha}A(Cys/Cys) lenses (Fig. 4A) . Moreover, F-actin staining signals were disorganized in epithelial and fiber cells of {alpha}A(Cys/Cys) lenses when compared to wild-type {alpha}A+/+ lenses.


Figure 4
View larger version (133K):
[in this window]
[in a new window]
  		FIGURE 4. Disrupted actin filaments and degenerated mitochondria in {alpha}A(Cys/Cys) embryonic lenses. (A) Fluorescent images of phalloidin- and 4',6'-diamino-2-phenylindole (DAPI)-labeled frozen lens sections of E16.5 embryos. Disrupted actin filaments are observed in the junctions between epithelial cells and fiber cells in the {alpha}A(Cys/Cys) lens compared with the {alpha}A+/+ lens (white arrowheads). (B) TEM data show normal mitochondria (arrowheads) in cortical fiber cells of E16.5 wild-type {alpha}A+/+ lens. Vacuoles and degenerated mitochondria (arrows) with severe loss of cristae and matrix are observed in cortical fiber cells of the E16.5 {alpha}A(Cys/Cys) embryonic lens. Scale bars: (A) 50 µm; (B) 500 nm.

 
TEM data showed that degenerated mitochondria (Fig. 4B , arrows) with severe loss of cristae and matrix or vacuoles were present in peripheral fiber cells of E16.5 {alpha}A(Cys/Cys) lenses, whereas normal mitochondria (arrowheads) were present in the cells of E16.5 wild-type {alpha}A+/+ lenses. Thus, disrupted F-actin and degenerated mitochondria are probably two major defects that abolish the characteristic features of epithelial and fiber cells in {alpha}A(Cys/Cys) lenses.

Increased Water-Insoluble Crystallins in {alpha}A(Y118D/Y118D) Lenses
Because the histology of {alpha}A-Y118D mutant lenses was relatively normal, we hypothesized that {alpha}A-Y118D mutant proteins fail to maintain the solubility of other lens proteins in mature fiber cells and cause nuclear cataracts. To test this hypothesis, we determined the changes of crystallin proteins between wild-type {alpha}A+/+ and {alpha}A(Y118D/Y118D) lenses by comparing the 2-DE protein profiles of wild-type {alpha}A+/+ and homozygous {alpha}A(Y118D/Y118D) lens samples.

The 2-DE data of {alpha}A+/+ and {alpha}A(Y118D/Y118D) water-soluble proteins were almost identical (Fig. 5A 5C) except one protein spot. The {alpha}Ains spot of {alpha}A(Y118D/Y118D) lenses shifted left due to the lower PI of the {alpha}Ains-Y118D protein and probably overlapped with the ßA1 spot (Figs. 5A 5C , arrows). 2-DE data of water-insoluble proteins showed that intact {alpha}A, {alpha}B, and several ß-crystallin isoforms, but not {gamma}-crystallin isoforms, were major components from wild-type {alpha}A+/+ lenses (Fig. 5B) . However, almost all crystallin proteins were present in the water-insoluble proteins of {alpha}A(Y118D/Y118D) lenses (Fig. 5D) . In addition, cleaved or phosphorylated forms of {alpha}A-Y118D proteins, several ß-crystallin isoforms and a substantial amount of different {gamma}-crystallin isoforms were also present. Thus, these results indicate that increased water-insoluble crystallins are correlated with the nuclear cataract of {alpha}A-Y118D mutant lenses.


Figure 5
View larger version (67K):
[in this window]
[in a new window]
  		FIGURE 5. Increased water-insoluble crystallin proteins, especially {gamma}-crystallins, in {alpha}A(Y118D/Y118D) lenses. (A, C) 2-DE results of water-soluble proteins (15 µg proteins are loaded) of lenses of 3-week-old mice. Crystallin proteins {alpha}A, {alpha}A-Y118D, and {alpha}B are labeled. Arrows: {alpha}Ains. (B, D) 2-DE results of water-insoluble proteins (one third of the pellet from two lenses was loaded) of lenses of 3-week-old mice. (D, arrowhead) Cleaved form of {alpha}A, P1, and P2 indicate two different phosphorylated forms of {alpha}A. The pH gradient is from 3 on the left side to 10 on the right side of the 2-DE images.

 

   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
This work identified and characterized a recessive mutant mouse line with whole cataracts and a dominant mutant mouse line with nuclear cataracts, caused by two new {alpha}A-crystallin gene mutations, {alpha}A-Cys and {alpha}A-Y118D. The recessive cataracts in {alpha}A(Cys/Cys) mutant mice are associated with disruptions of essential subcellular structures, such as F-actin and mitochondria, in embryonic lens fiber cells. These data indicate that {alpha}-crystallins are involved in maintaining the characteristic features of epithelial cells and in regulating appropriate formation of differentiating fiber cells during lens development. Although the mechanism for how {alpha}A-Cys mutant proteins disrupt these subcellular structures is not clear, this study provides direct evidence for a new hypothesis that the Arg54 residue in the N-terminal domain is essential for the function of {alpha}A-crystallin in lens epithelial and fiber cells during development. The nuclear cataracts of {alpha}A(Y118D/Y118D) mutant mice are associated with increased water-insoluble crystallins including {alpha}-, ß-, and {gamma}-isoforms. Therefore, {alpha}A-Y118D mutation reduces {alpha}A-crystallin’s ability to maintain the solubility of other crystallin proteins in the lens and that the nuclear cataract probably results from the light-scattering of abnormal aggregates of crystallin proteins in mature fiber cells.

Role of Insoluble and Modified Crystallins on Cataracts in {alpha}A-Y118D Mutant Mice
The {alpha}A-Y118D mutant protein adds a negatively charged residue (D), whereas both {alpha}A-R116C and {alpha}B-R120G mutant proteins lose a positively charged residue in the {alpha}-crystallin domain. Thus, the net charge change in these three mutant proteins is similar. The Arg116of {alpha}A-crystallin corresponds to the Arg120 of {alpha}B-crystallin. Both {alpha}A-R116C and {alpha}B-R120G mutations lead to dominant cataracts in humans.16 17 Biochemical studies have shown that {alpha}A-R116C and {alpha}B-R120G mutant subunits alter protein structure and decrease their chaperone-like function in vitro.24 25 Other studies have identified several subunit–subunit interaction sites of {alpha}B-crystallin in vitro.26 27 Mutant {alpha}B-R120G subunits also increase their binding capacity to desmin filaments, causing protein aggregation in desmin-related myopathy.28 A recent study reports that {alpha}B-R120G mutant proteins are unstable and more susceptible to proteolytic degradation, have enhanced interaction with their target proteins, and increase the size of their protein aggregates.29 Studies of biochemical properties of {alpha}A-Y118D mutant proteins may be very informative regarding the molecular basis of cataracts caused by the {alpha}A-Y118D mutation in vivo.

The {alpha}A-Y118D mutation causes an increase of insoluble, truncated, and phosphorylated crystallins in the lens. Many different posttranslational modifications of {alpha}-crystallin proteins have been identified in normal lenses, aging lenses, cataractous lenses, and lenses treated with different stimuli.30 31 These modifications can affect chaperone-like activity, size of protein aggregates, rate of subunit exchange, solubility, subcellular distribution, or other properties of the protein in vitro. However, it has been difficult to interpret the functional consequences of these modifications in vivo.32 33 Phosphorylation of Ser122 or Ser148 and C-terminal truncation of {alpha}A-crystallin proteins have been previously examined by 2-DE with mass spectrometry protein identification.33 34 The P1 and P2 spots in the {alpha}A-Y118D 2-DE gel (Fig. 5D) match phosphorylated Ser122or Ser148 protein forms, respectively, and the cleaved spot also matches the C-terminal 1-168 truncated protein.

Loss-of-Function Mutant Proteins in the {alpha}A-Cys and {alpha}A-His Mutant Mice
Unlike the {alpha}A-Y118D dominant mutation, both {alpha}A-Cys and {alpha}A-His are recessive mutations. It is unexpected that the {alpha}A-Cys mutation (nm3365) occurs at the same Arg54 residue as the previously reported {alpha}A-His (lop18) mutation. Both heterozygous {alpha}A(Cys/+) and {alpha}A(His/+) mutant mice have relatively normal lenses, whereas homozygous mice have severe cataracts. At present, the molecular mechanism for how the {alpha}A-Cys (or {alpha}A-His) mutation leads to unique defects in {alpha}A(Cys/Cys) or {alpha}A(His/His) lenses is unknown. Based on the fact that these heterozygous mice have transparent lenses, we assume that the mutant proteins expressed from one allele are nontoxic to lens cells and that wild-type {alpha}A-crystallin proteins expressed from the other allele are sufficient for normal lens formation. The last assumption is supported by the fact that heterozygous {alpha}A+/– knockout mice also have normal lenses.

Previous studies have suggested that {alpha}-crystallins are multifunctional proteins that play roles in various cellular events and that {alpha}-crystallins interact with other crystallin proteins, plasma membrane, and cytoskeletal components, such as actin, intermediate filaments, and microtubules.35 36 37 38 39 40 41 42 Studies of {alpha}A–/– lenses suggest that {alpha}A-crystallin is needed for preventing lens epithelial cell apoptosis.43 A recent study also suggests that {alpha}-crystallins play an important role in Golgi reorganization during the cell cycle.44 Thus, we hypothesize that R54C ({alpha}A-Cys) and R54H ({alpha}A-His) mutations impair the N-terminal domain that is necessary for the distinct functions of {alpha}A-crystallin in lens epithelial and fiber cells. These two mutations provide a useful experimental system that is different from the {alpha}A-Y118D mutation for investigating multiple functions of {alpha}A-crystallin during lens development.


   Acknowledgements
 
The authors thank Eric Wawrousek (National Eye Institute) for providing the {alpha}A/B-crystallin knockout mice, and Bruce Beutler and Xin Du at Scripps Research Institute for providing the ENU-induced mutant mice.


   Footnotes
 
Supported by National Eye Institute Grants EY13849, EY03897, EY015073, and EY07758.

Submitted for publication February 17, 2006; revised March 17, 2006; accepted May 22, 2006.

Disclosure: C. Xia, None; H. Liu, None; B. Chang, None; C. Cheng, None; D. Cheung, None; M. Wang, None; Q. Huang, None; J. Horwitz, None; X. Gong, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Xiaohua Gong, University of California, Berkeley, 693 Minor Hall, Vision Science Program and School of Optometry, Berkeley, CA 94720-2020; xgong{at}berkeley.edu.


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Klemenz R, Frohli E, Steiger RH, Schafer R, Aoyama A. Alpha B-crystallin is a small heat shock protein. Proc Natl Acad Sci USA. 1991;88:3652–3656.[Abstract/Free Full Text]
  2. Ingolia TD, Craig EA. Four small Drosophila heat shock proteins are related to each other and to mammalian alpha-crystallin. Proc Natl Acad Sci USA. 1982;79:2360–2364.[Abstract/Free Full Text]
  3. Horwitz J. Alpha-crystallin can function as a molecular chaperone. Proc Natl Acad Sci USA. 1992;89:10449–10453.[Abstract/Free Full Text]
  4. Bloemendal H, De Jong W, Jaenicke R, Lubsen NH, Slingsby C, Tardieu A. Ageing and vision: structure, stability and function of lens crystallins. Prog Biophys Mol Biol. 2004;86:407–485.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  5. King CR, Piatigorsky J. Alternative RNA splicing of the murine alpha A-crystallin gene: protein-coding information within an intron. Cell. 1983;32:707–712.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  6. Horwitz J. The function of alpha-crystallin in vision. Semin Cell Dev Biol. 2000;11:53–60.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  7. Horwitz J, Bova MP, Ding LL, Haley DA, Stewart PL. Lens alpha-crystallin: function and structure. Eye. 1999;13:403–408.[Medline][Order article via Infotrieve]
  8. Van Montfort R, Slingsby C, Vierling E. Structure and function of the small heat shock protein/alpha-crystallin family of molecular chaperones. Adv Protein Chem. 2001;59:105–156.[Web of Science][Medline][Order article via Infotrieve]
  9. Caspers GJ, Leunissen JA, de Jong WW. The expanding small heat-shock protein family, and structure predictions of the conserved "alpha-crystallin domain". J Mol Evol. 1995;40:238–248.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  10. Graw J, Loster J, Soewarto D, et al. Characterization of a new, dominant V124E mutation in the mouse alphaA-crystallin-encoding gene. Invest Ophthalmol Vis Sci. 2001;42:2909–2915.[Abstract/Free Full Text]
  11. Litt M, Kramer P, LaMorticella DM, Murphey W, Lovrien EW, Weleber RG. Autosomal dominant congenital cataract associated with a missense mutation in the human alpha crystallin gene CRYAA. Hum Mol Genet. 1998;7:471–474.[Abstract/Free Full Text]
  12. Mackay DS, Andley UP, Shiels A. Cell death triggered by a novel mutation in the alphaA-crystallin gene underlies autosomal dominant cataract linked to chromosome 21q. Eur J Hum Genet. 2003;11:784–793.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  13. Brady JP, Garland D, Duglas-Tabor Y, Robison WG, Jr, Groome A, Wawrousek EF. Targeted disruption of the mouse alpha A-crystallin gene induces cataract and cytoplasmic inclusion bodies containing the small heat shock protein alpha B-crystallin. Proc Natl Acad Sci USA. 1997;94:884–889.[Abstract/Free Full Text]
  14. Chang B, Hawes NL, Smith RS, Heckenlively JR, Davisson MT, Roderick TH. Chromosomal localization of a new mouse lens opacity gene (lop18). Genomics. 1996;36:171–173.[CrossRef][Medline][Order article via Infotrieve]
  15. Pras E, Frydman M, Levy-Nissenbaum E, et al. A nonsense mutation (W9X) in CRYAA causes autosomal recessive cataract in an inbred Jewish Persian family. Invest Ophthalmol Vis Sci. 2000;41:3511–3515.[Abstract/Free Full Text]
  16. Berry V, Francis P, Reddy MA, et al. Alpha-B crystallin gene (CRYAB) mutation causes dominant congenital posterior polar cataract in humans. Am J Hum Genet. 2001;69:1141–1145.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  17. Vicart P, Caron A, Guicheney P, et al. A missense mutation in the alphaB-crystallin chaperone gene causes a desmin-related myopathy. Nat Genet. 1998;20:92–95.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  18. Brady JP, Garland DL, Green DE, Tamm ER, Giblin FJ, Wawrousek EF. AlphaB-crystallin in lens development and muscle integrity: a gene knockout approach. Invest Ophthalmol Vis Sci. 2001;42:2924–2934.[Abstract/Free Full Text]
  19. Boyle DL, Takemoto L, Brady JP, Wawrousek EF. Morphological characterization of the Alpha A- and Alpha B-crystallin double knockout mouse lens. BMC Ophthalmol. 2003;3:3.[CrossRef][Medline][Order article via Infotrieve]
  20. Du X, Tabeta K, Hoebe K, et al. Velvet, a dominant Egfr mutation that causes wavy hair and defective eyelid development in mice. Genetics. 2004;166:331–340.[Abstract/Free Full Text]
  21. Okabe M, Ikawa M, Kominami K, Nakanishi T, Nishimune Y. ‘Green mice’ as a source of ubiquitous green cells. FEBS Lett. 1997;407:313–319.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  22. Liu H, Du X, Wang M, et al. Crystallin gamma B-I4F mutant protein binds to alpha-crystallin and affects lens transparency. J Biol Chem. 2005;280:25071–25078.[Abstract/Free Full Text]
  23. Shestopalov VI, Bassnett S. Development of a macromolecular diffusion pathway in the lens. J Cell Sci. 2003;116:4191–4199.[Abstract/Free Full Text]
  24. Kumar LV, Ramakrishna T, Rao CM. Structural and functional consequences of the mutation of a conserved arginine residue in alphaA and alphaB crystallins. J Biol Chem. 1999;274:24137–24141.[Abstract/Free Full Text]
  25. Bova MP, Yaron O, Huang Q, et al. Mutation R120G in alphaB-crystallin, which is linked to a desmin-related myopathy, results in an irregular structure and defective chaperone-like function. Proc Natl Acad Sci USA. 1999;96:6137–6142.[Abstract/Free Full Text]
  26. Ghosh JG, Clark JI. Insights into the domains required for dimerization and assembly of human alphaB crystallin. Protein Sci. 2005;14:684–695.[CrossRef][Medline][Order article via Infotrieve]
  27. Sreelakshmi Y, Sharma KK. Recognition sequence 2 (residues 60-71) plays a role in oligomerization and exchange dynamics of alphaB-crystallin. Biochemistry. 2005;44:12245–12252.[Medline][Order article via Infotrieve]
  28. Perng MD, Wen SF, van den IP, Prescott AR, Quinlan RA. Desmin aggregate formation by R120G alphaB-crystallin is caused by altered filament interactions and is dependent upon network status in cells. Mol Biol Cell. 2004;15:2335–2346.[Abstract/Free Full Text]
  29. Treweek TM, Rekas A, Lindner RA, et al. R120G alphaB-crystallin promotes the unfolding of reduced alpha-lactalbumin and is inherently unstable. FEBS J. 2005;272:711–724.[CrossRef][Medline][Order article via Infotrieve]
  30. Groenen PJ, Merck KB, de Jong WW, Bloemendal H. Structure and modifications of the junior chaperone alpha-crystallin. From lens transparency to molecular pathology. Eur J Biochem. 1994;225:1–19.[Web of Science][Medline][Order article via Infotrieve]
  31. Derham BK, Harding JJ. Alpha-crystallin as a molecular chaperone. Prog Retin Eye Res. 1999;18:463–509.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  32. Takemoto LJ. Differential phosphorylation of alpha-A crystallin in human lens of different age. Exp Eye Res. 1996;62:499–504.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  33. Ueda Y, Duncan MK, David LL. Lens proteomics: the accumulation of crystallin modifications in the mouse lens with age. Invest Ophthalmol Vis Sci. 2002;43:205–215.[Abstract/Free Full Text]
  34. Schaefer H, Marcus K, Sickmann A, Herrmann M, Klose J, Meyer HE. Identification of phosphorylation and acetylation sites in alphaA-crystallin of the eye lens (mus musculus) after two-dimensional gel electrophoresis. Anal Bioanal Chem. 2003;376:966–972.[Medline][Order article via Infotrieve]
  35. Tsvetkova NM, Horvath I, Torok Z, et al. Small heat-shock proteins regulate membrane lipid polymorphism. Proc Natl Acad Sci USA. 2002;99:13504–13509.[Abstract/Free Full Text]
  36. Iwaki T, Iwaki A, Tateishi J, Goldman JE. Sense and antisense modification of glial alpha B-crystallin production results in alterations of stress fiber formation and thermoresistance. J Cell Biol. 1994;125:1385–1393.[Abstract/Free Full Text]
  37. Nicholl ID, Quinlan RA. Chaperone activity of alpha-crystallins modulates intermediate filament assembly. EMBO J. 1994;13:945–953.[Web of Science][Medline][Order article via Infotrieve]
  38. Carter JM, Hutcheson AM, Quinlan RA. In vitro studies on the assembly properties of the lens proteins CP49, CP115: coassembly with alpha-crystallin but not with vimentin. Exp Eye Res. 1995;60:181–192.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  39. Wang K, Spector A. alpha-crystallin stabilizes actin filaments and prevents cytochalasin-induced depolymerization in a phosphorylation-dependent manner. Eur J Biochem. 1996;242:56–66.[Web of Science][Medline][Order article via Infotrieve]
  40. Wisniewski T, Goldman JE. Alpha B-crystallin is associated with intermediate filaments in astrocytoma cells. Neurochem Res. 1998;23:385–392.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  41. Paulin D, Huet A, Khanamyrian L, Xue Z. Desminopathies in muscle disease. J Pathol. 2004;204:418–427.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  42. Cobb BA, Petrash JM. alpha-Crystallin chaperone-like activity and membrane binding in age-related cataracts. Biochemistry. 2002;41:483–490.[CrossRef][Medline][Order article via Infotrieve]
  43. Xi JH, Bai F, Andley UP. Reduced survival of lens epithelial cells in the alphaA-crystallin-knockout mouse. J Cell Sci. 2003;116:1073–1085.[Abstract/Free Full Text]
  44. Gangalum RK, Schibler MJ, Bhat SP. Small heat shock protein alphaB-crystallin is part of cell cycle-dependent Golgi reorganization. J Biol Chem. 2004;279:43374–43377.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 IOVSHome page
Q. Huang, L. Ding, K. B. Phan, C. Cheng, C.-h. Xia, X. Gong, and J. Horwitz
Mechanism of Cataract Formation in {alpha}A-crystallin Y118D Mutation
Invest. Ophthalmol. Vis. Sci., June 1, 2009; 50(6): 2919 - 2926.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J.-h. Xi, F. Bai, J. Gross, R. R. Townsend, A. S. Menko, and U. P. Andley
Mechanism of Small Heat Shock Protein Function in Vivo: A KNOCK-IN MOUSE MODEL DEMONSTRATES THAT THE R49C MUTATION IN {alpha}A-CRYSTALLIN ENHANCES PROTEIN INSOLUBILITY AND CELL DEATH
J. Biol. Chem., February 29, 2008; 283(9): 5801 - 5814.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xia, C.-h.
Right arrow Articles by Gong, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xia, C.-h.
Right arrow Articles by Gong, X.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS