(Investigative Ophthalmology and Visual Science. 2006;47:3085-3097.)
© 2006 by The Association for Research in Vision and Ophthalmology, Inc.
DOI: 10.1167/iovs.05-1600
Maculopathy Due to the R345W Substitution in Fibulin-3: Distinct Clinical Features, Disease Variability, and Extent of Retinal Dysfunction
Michel Michaelides,1,2
Sharon A. Jenkins,1
Milam A. Brantley, Jr,3
Richard M. Andrews,1
Naushin Waseem,2
Vy Luong,2
Kevin Gregory-Evans,4,5
Shomi S. Bhattacharya,2
Fred W. Fitzke,2 and
Andrew R. Webster1,2
1From the Moorfields Eye Hospital, City Road, London, United Kingdom;
2Institute of Ophthalmology, University College London, London, United Kingdom;
3Department of Ophthalmology and Visual Sciences, Washington University School of Medicine, St. Louis, Missouri;
4Department of Ophthalmology, Western Eye Hospital, London, United Kingdom; and
5Imperial College London, Laboratory Block, London, United Kingdom.
 |
Abstract
|
|---|
PURPOSE. To determine (1) clinical features that distinguish maculopathy due to the R345W substitution in fibulin-3 from other forms of inherited or early-onset drusen, (2) the phenotypic variability, and (3) the extent of retinal disease in those with a positive molecular diagnosis.
METHODS. Affected individuals underwent ophthalmic examination, digital color fundus photography, fundus autofluorescence (AF) imaging, and psychophysical testing with automated photopic and dark-adapted perimetry and fine matrix mapping. Blood samples were taken for DNA extraction and screening for the R345W mutation in fibulin-3. Patients were subsequently divided into mutation-positive and -negative groups, to compare the identified phenotypic findings in these two sets of subjects.
RESULTS. Twenty-nine subjects from 19 families were ascertained with inherited or early-onset drusen. Twenty-four (83%) subjects from 15 families were found to harbor the R345W fibulin-3 mutation. Peripapillary deposition and a radial distribution of macular drusen were consistent, distinguishing signs in the mutation-positive group. Subretinal neovascular membrane (SRNVM) was a rare occurrence, affecting only 1 of 48 eyes, whereas hyperpigmentation and atrophy of the retinal pigment epithelium (RPE) were common in older mutation-positive patients. Increased AF corresponding to the drusen was detected in both the mutation-positive and -negative groups. The phenotype in the group of patients positive for the R345W mutation was extremely variable, with evidence of interocular, intrafamilial, and interfamilial variability in visual loss, natural history, ophthalmoscopic findings, autofluorescence imaging, and psychophysical data. The novel finding of nonpenetrance was observed in a 62-year-old asymptomatic, mutation-positive man. The findings from detailed perimetry performed on a subset of subjects were consistent with the presence of widespread retinal dysfunction not isolated to the macula.
CONCLUSIONS. Marked inter- and intrafamilial variation associated with the fibulin-3 R345W mutation in terms of retinal appearance, severity, progression, and nonpenetrance were identified. It was noted that SRNVM is a rare occurrence in R345W fibulin-3 maculopathy. These findings are helpful for advice regarding prognosis and for genetic counseling. The findings established that the presence of peripapillary deposit is highly likely to indicate that a patient carries the R345W mutation.
Autosomal dominant drusen (ADD; OMIM 126600; Online Mendelian Inheritance in Man, http://www.ncbi.nlm.nih.gov/Omim/ provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD), a dominantly inherited maculopathy, was originally described separately in families from the UK,1 and the Leventine Valley of Switzerland,2 although it is now clear that they are the same disorder. Characteristic findings include early-onset drusen at the posterior pole, often deposited in a radial configuration; deposit at the optic disc margin; drusen nasal to the optic disc; atrophy of the RPE at the macula; and subretinal neovascular membrane formation.3 4 5 Several other monogenic macular dystrophies have been described that are also principally characterized by posterior pole drusen, for which chromosomal loci have been mapped or disease-causing mutations identified.6 7 8 9 10 These drusen-associated phenotypes have been studied in detail particularly because of their similarity to age-related macular degeneration (ARMD), the leading cause of blindness in the developed world. An understanding of their causative genes may provide new insights into the mechanisms of macular dysfunction in ARMD.
ADD has been mapped to chromosome 2, region p16, and a single missense mutation (Arg345Trp; R345W) has been identified in the fibulin-3 gene.11 However, several studies have shown that only a proportion of patients with early-onset drusen have this mutation.12 13 14 15 Fibulin-3 (previously known as EFEMP1) is expressed in the RPE and encodes an extracellular matrix glycoprotein of uncertain function. There is evidence that fibulin-3 protein interacts with TIMP3, a matrix-bound inhibitor of matrix metalloproteinases; with mutations in TIMP3 causing Sorsby maculopathy, another drusen-associated dystrophy.16 It has also been proposed that misfolding and aberrant accumulation of mutant fibulin-3 within RPE cells and between the RPE and Bruchs membrane may underlie drusen formation in ADD and ARMD. Fibulin-3 itself does not appear to be a major component of the drusen.17
This study includes 19 probands presenting consecutively to the clinic with a retinal appearance or family history deemed consistent clinically with ADD. Family members were also examined when possible. The R345W mutation was confirmed in some but not all patients, and the range of severity of those mutation-positive patients was surveyed. In a subset of patients, the extent of retinal dysfunction was determined through psychophysical testing.
 |
Methods
|
|---|
Patients
Subjects (29 patients in total; consisting of 11 simplex cases and 18 individuals from 8 different families [A-H]) with posterior pole drusen at an early age (<50 years old) or with an autosomal dominant family history were recruited, in keeping with ADD. After informed consent was obtained, a detailed medical and ophthalmic history was taken, and a full ophthalmic examination performed. Patients underwent color fundus photography, fundus autofluorescence (AF) imaging, and automated photopic and dark-adapted perimetry. Three patients also underwent detailed light- and dark-adapted fine matrix mapping (FMM). Blood samples were taken from all individuals for DNA extraction and subsequent screening of fibulin-3 for the R345W mutation. The protocol of the study adhered to the provisions of the Declaration of Helsinki and was approved by the local Ethics Committee.
Clinical Methods
Fundus autofluorescence (AF) imaging was undertaken in 18 patients, with a confocal scanning laser ophthalmoscope (either the Zeiss Prototype, Carl Zeiss Inc, Oberkochen, Germany; or the HRA, Heidelberg, Germany).
Fifteen subjects underwent detailed perimetry and three also had FMM, thereby permitting assessment of retinal thresholds at multiple discrete locations. Static threshold perimetry in the light- and dark-adapted states was performed with a perimeter (Humphrey field analyzer; Allergan Humphrey, Hertford, UK).18 19 20 Briefly, for dark-adapted visual fields, the pupil was dilated with 2.5% (wt/vol) phenylephrine hydrochloride and 1% (wt/vol) tropicamide, and the eyes were dark adapted for 45 minutes. The field analyzer was modified for use in dark-adapted conditions.18 19 20 An infrared source illuminated the bowl, and an infrared monitor (Phillips, Eindhoven, The Netherlands) was used to detect eye movements. Fields were recorded using the 30-2 program, with a red (dominant wavelength, 650 nm) and then blue (dominant wavelength, 450 nm) filter in the stimulus beam. The photopic and scotopic retinal threshold values were also subsequently superimposed on the color fundus and AF images with custom image-analysis software.
FMM of light- and dark-adapted retinal thresholds was performed by using a previously described protocol.21 22 23 24 Briefly, in this technique a modified field analyzer was used (Humphrey; Carl Zeiss Meditec, Inc). For the photopic FMM measurements, standard Humphrey size-III target white flashes were used on a standard bowl illumination of 31.5 apostilbs. Scotopic retinal function was measured after pupil dilation and dark adaptation for 45 minutes. For scotopic FMM measurements, the size III target blue flashes were presented with the bowl illumination switched off under scotopic conditions. Four red-lightemitting diodes in a small-diamond configuration were used as a fixation target, with the accuracy of fixation monitored by means of an infrared camera. For both photopic and scotopic FMM measurements, one hundred positions on a square 10 x 10 matrix over a 9° x 9° test field were presented with a size III target at 1° intervals. The numerical matrix of the luminance sensitivity at each of the test locations was then used to generate a surface or contour plot showing the size and location of luminance sensitivity gradients across the grid (contour steps: 0.1 log unit). The numerical matrices and luminance sensitivity contour plots were superimposed onto the color fundus and AF images with custom image-analysis software. Accurate superimposition was achieved by aligning anatomic landmarks, such as the center of the optic disc and the fovea, with the corresponding perimetry landmarks, such as the center of the blind spot and fixation.
Fibulin-3 Mutation Screening
Total genomic DNA was extracted from blood samples from all subjects with a kit (Nucleon Biosciences, Deeside, UK). The C-to-T transition at the first nucleotide of codon 345 of fibulin-3 (exon 10), which would result in the R345W substitution,11 was screened for by direct sequencing of PCR products (model 3100 Genetic Analyzer; Applied Biosystems, Inc. [ABI], Foster City, CA), using the following primer sequences in both the PCR and sequencing reactions: Ex10F (forward): CTTGCAAACAGAATCTGCCAG; Ex10R (reverse): TGGTGTTAGAATGTAGGGATCTTG.
 |
Results
|
|---|
Clinical
A large panel of 29 patients, consisting of 11 simplex cases and 18 individuals from 8 different families, with posterior pole drusen at an early age (<50-years-old) or with an autosomal dominant family history was ascertained. Most of the patients were British and white. After a detailed phenotypic investigation, these subjects were subdivided into two groups: patients who harbored the R345W fibulin-3 mutation (24 patients) and those who were negative for the mutation (5 patients). Clinical findings are summarized in Tables 1 2 3 4 and Figures 1 2 3 4 5 6 .

View larger version (76K):
[in this window]
[in a new window]
|
FIGURE 1. Fundus fluorescein angiogram (early and late phase images) of patient 4 consistent with a classic SRNVM. Only one patient in the case series had evidence of previous SRNVM.
|
|

View larger version (113K):
[in this window]
[in a new window]
|
FIGURE 2. Fundus photographs and autofluorescence images demonstrating the intra- and interfamilial variability in phenotype in R345W-positive patients. (A) Patient 1A: bilateral areas of macular RPE atrophy and pigmentation and (B) increased AF corresponding to the areas of macular RPE change with localized areas of increased AF at the right optic disc margin. Normal AF in left eye. (C) Patient 2A: bilateral areas of inferiorly localized drusen with encroachment on fixation in the right eye and bilateral peripapillary drusen and (D) areas of increased AF corresponding to the macular drusen. Reduced AF is also seen in some areas occupied by drusen. (E) Patient 4: bilateral confluent macular drusen, peripapillary drusen and drusen nasal to the disc, macular atrophy, and pigmentation, with an old right SRNVM. (F) Patient 5B: bilateral densely confluent macular drusen centrally (OD > OS) and radial drusen, with some peripapillary drusen and (G) areas of increased AF corresponding to the dense drusen centrally associated with a generalized reduction of macular AF. (H) Patient 6B: bilateral multiple radial drusen, peripapillary drusen, and drusen nasal to the optic disc and (I) areas of increased AF corresponding to the macular drusen. (J) Patient 7C: bilateral confluent macular drusen centrally with multiple radial drusen and peripapillary drusen. (K) Patient 8C: bilateral confluent macular drusen centrally with multiple radial drusen, and peripapillary drusen. (L) Patient 9D: bilateral macular and peripapillary drusen. (M) Patient 10D: bilateral confluent macular drusen, peripapillary drusen, and drusen nasal to the disc, with macular atrophy and pigmentation (OS > OD) and (N) generalized reduction in macular AF, with areas of increased AF corresponding to the macular drusen.
|
|

View larger version (132K):
[in this window]
[in a new window]
|
FIGURE 3. Fundus photographs and autofluorescence images demonstrating the intra- and interfamilial variability in phenotype in R345W-positive (AD) and -negative (EJ) patients. (A) Patient 11: bilateral densely confluent macular drusen with sparing of fixation, peripapillary drusen, and drusen nasal to the disc and (B) areas of increased AF corresponding to the macular drusen. (C) Patient 14: bilateral drusen and RPE changes encircling the macula, and peripapillary drusen. (D) Patient 20F: bilateral confluent macular drusen temporal to the macula, with multiple radial drusen, peripapillary drusen, and drusen nasal to the disc. (E) Patient 25: bilateral confluent macular drusen with widely scattered fine drusen, drusen nasal to the disc, and areas of right macular atrophy and (F) areas of increased AF corresponding to the minority of the macular drusen. (G) Patient 27: bilateral confluent macular drusen, with macular atrophy (OD > OS) and (H) areas of increased AF corresponding to the macular drusen. (I) Patient 29H: bilateral confluent macular drusen and (J) areas of increased AF corresponding to the macular drusen.
|
|

View larger version (108K):
[in this window]
[in a new window]
|
FIGURE 4. Fundus photographs and autofluorescence images demonstrating marked intrafamilial variability in phenotype in four members of an R345W-positive family (family G; Table 1 ) (AE) and progression in an R345W-positive subject (patient 13) over a 10-year period (FH). (AC, E) Patients 21G24G: in the four members of family G, variability in both the degree of macular atrophy and the density, distribution, and size of drusen could be seen. Radial drusen were present only in patient 24G. (D) Patient 23G showed areas of increased AF corresponding to the macular drusen. (FH) In patient 13 progression was seen over a 10-year period with increasing bilateral confluent drusen, macular atrophy, and pigmentation.
|
|

View larger version (57K):
[in this window]
[in a new window]
|
FIGURE 5. Photopic, scotopic blue, and scotopic red 30° static threshold perimetry data of patients 8C, 16E, and 17E. On photopic testing, all three patients showed central sensitivity reduction, with areas of peripheral loss being more marked in the superior visual field. Scotopic testing showed central reduction of both cone and rod sensitivities, with peripheral loss being more marked in the inferior retina. In patient 8C, scotopic testing revealed a greater elevation in rod than in cone thresholds; whereas in patients 16E and 17E, the elevation in cone and rod thresholds was similar.
|
|

View larger version (117K):
[in this window]
[in a new window]
|
FIGURE 6. FMM data from patient 20F. (A, B) Photopic FMM luminance sensitivity data superimposed on color fundus images. (C, D) Scotopic FMM data superimposed onto color fundus images. Photopic FMM testing showed a mild reduction in sensitivity corresponding to the drusen deposits, with scotopic data demonstrating moderate reduction of rod sensitivity especially over drusen; consistent with a greater loss in rod than in cone sensitivity.
|
|
The onset of symptoms was in the fourth and fifth decades of life in both groups of patients (Table 4) . Subjects predominantly presented with reduced central vision; however, a significant proportion described difficulty in adapting to dark conditions (nine patients), a symptom not frequently previously reported in ADD (Table 4) .3 25 26 27 Dark-adaptometry would be helpful in this group of subjects to investigate their reported difficulties with dark-adaptation further. Six individuals were asymptomatic, with the three oldest of these subjects (patients 1A, aged 62 years; 9D, 60 years; and 29H, 58 years) being unusual, since it has been reported that patients are generally symptomatic in their 30s and 40s.3 25 26 27 Symptomatic patients were often aware of a gradual deterioration over many years. In patients for whom documentation was available, a wide variability in the rate of progression was seen, with some subjects maintaining good visual acuity over a 15-year period (patient 3) and others suffering marked visual loss over a similar time period (patients 13 and 16E; Table 3 ). Only one subject (patient 4) had evidence of a subretinal neovascular membrane (Fig. 1) , making it a rare complication in this phenotype and implying that progressive macular atrophy is the predominant cause of loss of vision. Available color vision data suggested that color vision loss is not an early finding, since subjects with good visual acuity had retained color discrimination (patients 1A, 6B, 12, 14, 20F, and 24G). However, in two subjects with asymmetrical visual acuity loss (patients 4 and 5B), it was interesting to note the presence of bilateral poor color vision despite markedly asymmetrical visual acuities, suggesting that once the degenerative process begins, color discrimination is lost before a decline in acuity. The observed interocular phenotypic asymmetry, in terms of both visual acuity and fundus appearance, illustrates one aspect of the prominent variability identified in the R345W mutation-positive group (Table 1 ; Figs. 2 3 4 ).
Ophthalmoscopic and AF imaging findings were reviewed to ascertain whether there were any differences between subjects with the R345W mutation (positive) and those negative for the mutation. There was a wide range of macular appearances, including variation in drusen location and characteristics (number, size, and subtype), in both groups (Figs. 2 3 4) . The peripheral retina was normal in all cases. Two phenotypic features that were uniformly absent in the R345W negative group were a complete lack of deposit abutting the optic nerve head (peripapillary) and the absence of drusen in a radial distribution (Fig. 3) . In contrast, only one subject (patient 1A) positive for the mutation did not have evidence of peripapillary deposit on ophthalmoscopy, confirming that the presence of this sign is an indicator of an R345W fibulin-3 variant. Patient 1A, however, had evidence of areas of increased AF at the right optic disc margin, which is likely to represent peripapillary drusen, thereby suggesting that AF imaging may be a helpful additional technique in selected cases (Fig. 2) . Drusen located nasal to the optic disc were present in both the positive and negative R345W groups. Within the R345W positive group a marked variability in retinal phenotype was seen, both in terms of specific drusen features (density, distribution, and size) in subjects with a typical overall ADD appearance, but also with regard to some subjects (patients 2A, 5B, 9D, and 14) having very unusual and uncharacteristic posterior pole findings (Figs. 2 3) . Patients 2A, 5B, 9D, and 14 all had an atypical drusen distribution compared to other more classic appearances (Figs. 2 3) , with patient 2A having highly localized drusen bilaterally, patient 5Bs confluent drusen giving the appearance of retinal fibrosis, and patient 14 having marked pigmentary changes encircling the macula, showing some resemblance to the macular dystrophy seen in association with maternally inherited diabetes and deafness.
Although radial placement of macular drusen was a common finding, this was variable even between members of the same family, with families F and G being examples (Fig. 4) . Therefore, in addition to interfamilial variation (Figs. 2 3) , a wide intrafamilial variability of retinal phenotype and disease severity was also seen in R345W positive families (Figs. 2 4 ; Table 1 ). For example, family A demonstrated a marked difference between the father (1A), who was asymptomatic with only minor macular RPE clumping (Fig. 2) , and his daughter (2A), who had florid drusen accumulation and was aware of reduced vision. The nonpenetrance identified in patient 1A (despite his being 62 years old) is most unusual, with such a mild phenotype in a subject shown to harbor the R345W mutation not having been previously reported. In contrast, family C demonstrated variability in disease severity despite having a very similar retinal appearance, with the father (7C) being mildly affected with 6/6 visual acuity, and his daughter (8C) having reduced vision (6/24) from her early 20s (Fig. 2 ; Table 4 ). Marked differences in retinal phenotype and disease severity were also clearly seen between members of all the remaining R345W positive families; most clearly seen in family G (Table 1 ; Fig. 4 ). There was only one family (H) in the R345W negative group, with these siblings having a similar retinal phenotype (Fig. 3) .
In both the R345W-positive and -negative groups, areas of increased AF were detected that corresponded to the drusen in all subjects (Table 1 ; Figs. 2 3 4 ). However, not all the retinal drusen seen ophthalmoscopically were associated with increased AF, with some displaying absent or reduced AF. Reduced AF was present in areas of retinal atrophy identified ophthalmoscopically. In some cases, in addition to the increased AF associated with the drusen, a generalized reduction in macular AF was evident (patients 2A, 5B, 10D, 14; Table 1 ; Fig. 2 ).
Fifteen subjects (11 R345W-positive patients; 4 negative) underwent detailed light- and dark-adapted perimetry. The findings are summarized in Table 1 . In most of the subjects, photopic perimetry testing demonstrated a reduction of variable magnitude in central visual field sensitivity, and areas of midperipheral field loss, in the order of 10 to 20 dB (Fig. 5) . Dark-adapted perimetry revealed central and midperipheral sensitivity loss in the order of 10 to 30 dB, with the superior visual field being more affected than the inferior (Fig. 5) . In the R345W-positive group, 10 subjects had abnormal dark-adapted perimetry: Of these, six subjects had similar rod and cone threshold elevations, three had greater elevation of cone thresholds (1A, 10D, 11), and the remaining one (8C) had rod thresholds that were elevated more than the cone thresholds (Fig. 5) . In the R345W-negative group, three subjects had evidence of cone thresholds being elevated to a greater extent than rod thresholds.
Three R345W-positive patients underwent FMM (Table 2 , Fig. 6 ). In two subjects, photopic FMM revealed a mild reduction in sensitivity that corresponded to the drusen deposits (patients 2A and 20F). In the third patient, a generalized reduction in central sensitivity was detected. In all three subjects, scotopic FMM revealed a greater reduction in rod than in cone sensitivity, with rod threshold elevation not being restricted to the drusen-laden retina. In patient 20F, rod sensitivity loss was most marked where the drusen deposition was most prominent (Fig. 6) .
Fibulin-3 Mutation Screening
Mutation screening identified a group of 24 individuals (patients 124) who harbored the R345W fibulin-3 mutation. The remaining five subjects (patients 2529) did not harbor the disease-causing sequence variant.
 |
Discussion
|
|---|
Once the molecular cause of a disorder has been ascertained it is important to return to the clinic and re-examine the phenotype associated with those patients that carry disease alleles. Molecular diagnosis allows a more complete ascertainment of cases and family members and thereby a better estimate of the spectrum of severity of the condition. Such natural history data is invaluable in giving advice to those found to be mutation-positive and will also prove to be important in the event of future therapies. Furthermore, if clinical signs are found to be specific to the disorder, they help the clinician to identify further cases on clinical grounds alone. With these issues in mind, we collected patients presenting consecutively to the clinic with a phenotype of suspected ADD, identified affected family members when possible, and subjected them to detailed clinical examination.
Fibulin-3 maculopathy shows both intrafamilial and interfamilial variable expressivity, even accounting for the progressive nature of the condition. The novel finding of nonpenetrance in a 62-year-old carrier is important for two reasons. First, being mutation positive is compatible with normal visual function until at least that age. Second, the finding of normal parents of a person with signs suggestive of ADD should not exclude the disorder. Peripapillary deposit and radial macular drusen are consistent findings in mutation-positive patients but not in those that are negative, and the presence of these signs should alert the clinician to the diagnosis of the disorder. Drusen located nasal to the optic disc were found frequently in both patient groups. We also established that SRNVM is an uncommon complication in ADD and that macular atrophy is the principal cause of loss of vision. It has been proposed that mutant fibulin-3 may lead to upregulation of VEGF expression and thereby lead to SRNVM.28
AF imaging allows the visualization of the RPE by taking advantage of the fluorescent properties of lipofuscin.29 30 There are limited data on AF imaging in ADD,31 and imaging findings have not been reported in patients with a known fibulin-3 mutation status. Decreased AF was present in areas of retinal atrophy seen ophthalmoscopically. In four patients, a generalized reduction in macular AF was evident, suggesting a widespread macular RPE dysfunction. In both the positive and negative R345W groups, areas of increased AF were detected that corresponded to the drusen in all tested subjects. However, although the majority of drusen were associated with increased AF, some displayed absent or reduced AF. It is noteworthy that the drusen observed in other inherited macular dystrophies also display increased AF, including MCDR3,8 Sorsby fundus dystrophy (Webster AR, unpublished data, 2005) and North Carolina macular dystrophy (Michaelides M, unpublished data, 2005). The increased AF associated with the drusen observed in monogenic macular dystrophies is in direct contrast to drusen in ARMD, where there is generally little correspondence between the distribution of drusen and AF, although large soft foveal drusen may be associated with increased AF.30 31 32 33 However, the drusen in the patients in our panel (both R345W positive and negative) are present from a young age, and are likely to have a pathogenesis different from those in the ageing eye. Autofluorescence imaging may have a role in identifying peripapillary drusen not readily identifiable ophthalmoscopically and thereby may help to prioritize patients for R345W screening, with Patient 1A representing an example in which AF imaging was effective in revealing the presence of peripapillary drusen after a fundus examination with normal findings. Recently, peripapillary and macular drusen have also been effectively imaged using optical coherence tomography.34 However, the identification of increased peripapillary AF corresponding to the drusen in fibulin-3 maculopathy is in direct contrast to the normal peripapillary AF shown in ABCA4-related dystrophies.35
Perimetry performed on subjects in our panel is consistent with the presence of more widespread retinal dysfunction outside the macula and suggests that subtle photoreceptor dysfunction may precede drusen formation. The three R345W-positive patients who underwent scotopic FMM showed higher thresholds in response to scotopic than to photopic stimuli, as has been demonstrated in atrophy associated with ARMD.24 This observation may suggest a greater susceptibility to rod than to cone dysfunction in the disorder. The retention of autofluorescence (thereby RPE function) and cone sensitivity overlying the deposits suggests that the neurosensory retina/RPE may retain function and anatomy for a significant period, despite the formation of extensive deposit, and hence may provide a window of opportunity for therapeutic intervention.
The identification in our study of patients with early-onset drusen negative for the R345W mutation is consistent with previous reports of genetic heterogeneity in the early-onset drusen phenotype.12 13 14 15 These findings suggest the existence of further genes causing early-onset drusen that have yet to be identified.
The variable-expressivity and nonpenetrance observed in fibulin-3 maculopathy is likely to be due to environmental or other genetic modifying factors. One environmental factor that may play a role is smoking, an established risk factor for the development of ARMD,36 and this would warrant further investigation in our cohort and others. Potential modifying genetic factors include alleles of CFH and LOC387715, which have both been recently identified as significant risk factors for early and late ARMD.37 38 39 40 41 42 This issue merits further study in fibulin-3 maculopathy. A further possibility is that the phenotype is affected by variations in other proteins that either directly interact with fibulin-3 or are involved in extracellular matrix metabolism, with potential candidates, including TIMP3.16 Given the range of variation in the disorder, the future identification of such modifying factors may allow further insights into the management of mutation-positive individuals in the hope of maintaining vision into later life.
 |
Acknowledgements
|
|---|
The authors thank the patients who kindly agreed to take part in the study and the many ophthalmologists throughout the UK for their referral of patients.
 |
Footnotes
|
|---|
Supported by the Foundation Fighting Blindness and The Special Trustees of Moorfields Eye Hospital.
Submitted for publication December 15, 2005; revised February 8, 2006; accepted April 28, 2006.
Disclosure: M. Michaelides, None; S.A. Jenkins, None; M.A. Brantley, Jr, None; R.M. Andrews, None; N. Waseem, None; V. Luong, None; K. Gregory-Evans, None; S.S. Bhattacharya, None; F.W. Fitzke, None; A.R. Webster, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: Andrew R. Webster, Institute of Ophthalmology, University College London, 11-43 Bath Street, London EC1V 9EL, UK; andrew.webster{at}ucl.ac.uk.
 |
References
|
|---|
- Doyne RW. A peculiar condition of choroiditis occurring in several members of the same family. Trans Ophthalmol Soc UK. 1899;19:71.
- Vogt A. Die Ophthalmoskopie im rotfreien Licht. Graefe A Saemisch T eds. Handbuch der gesammten Augenheilkunde. Untersuchungsmethoden. 1925; 3rd ed. 1118. Leipez, Verlag von Wilhelm Engelman Berlin.
- Marmorstein L. Association of EFEMP1 with malattia leventinese and age-related macular degeneration: a mini-review. Ophthalmic Genet. 2004;25:219226.[CrossRef][Medline][Order article via Infotrieve]
- Pager CK, Sarin LK, Federman JL, et al. Malattia leventinese presenting with subretinal neovascular membrane and hemorrhage. Am J Ophthalmol. 2001;131:517518.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Zech JC, Zaouche S, Mourier F, et al. Macular dystrophy of malattia leventinese: a 25 year follow up. Br J Ophthalmol. 1999;83:11951196.[Medline][Order article via Infotrieve]
- Weber BH, Vogt G, Pruett RC, Stohr H, Felbor U. Mutations in the tissue inhibitor of metalloproteinases-3 (TIMP3) in patients with Sorsbys fundus dystrophy. Nat Genet. 1994;8:352356.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Small KW, Udar N, Yelchits S, et al. North Carolina macular dystrophy (MCDR1) locus: a fine resolution genetic map and haplotype analysis. Mol Vis. 1999;5:3842.[Medline][Order article via Infotrieve]
- Michaelides M, Johnson S, Tekriwal AK, et al. An early-onset autosomal dominant macular dystrophy (MCDR3) resembling North Carolina macular dystrophy maps to chromosome 5. Invest Ophthalmol Vis Sci. 2003;44:21782183.[Abstract/Free Full Text]
- Francis PJ, Johnson S, Edmunds B, et al. Genetic linkage analysis of a novel syndrome comprising North Carolina-like macular dystrophy and progressive sensorineural hearing loss. Br J Ophthalmol. 2003;87:893898.[Abstract/Free Full Text]
- Kniazeva M, Traboulsi EI, Yu Z, et al. A new locus for dominant drusen and macular degeneration maps to chromosome 6q14. Am J Ophthalmol. 2000;130:197202.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Stone EM, Lotery AJ, Munier FL, et al. A single EFEMP1 mutation associated with both Malattia Leventinese and Doyne honeycomb retinal dystrophy. Nat Genet. 1999;22:199202.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Tarttelin EE, Gregory-Evans CY, Bird AC, et al. Molecular genetic heterogeneity in autosomal dominant drusen. J Med Genet. 2001;38:381384.[Abstract/Free Full Text]
- Sauer CG, White K, Kellner U, et al. EFEMP1 is not associated with sporadic early onset drusen. Ophthalmic Genet. 2001;22:2734.[Medline][Order article via Infotrieve]
- Guymer RH, McNeil R, Cain M, et al. Analysis of the Arg345Trp disease-associated allele of the EFEMP1 gene in individuals with early onset drusen or familial age-related macular degeneration. Clin Experiment Ophthalmol. 2002;30:419423.[Medline][Order article via Infotrieve]
- Narendran N, Guymer RH, Cain M, Baird PN. Analysis of the EFEMP1 gene in individuals and families with early onset drusen. Eye. 2005;19:1115.[Medline][Order article via Infotrieve]
- Klenotic PA, Munier FL, Marmorstein LY, Anand-Apte B. Tissue inhibitor of metalloproteinases-3 (TIMP-3) is a binding partner of epithelial growth factor-containing fibulin-like extracellular matrix protein 1 (EFEMP1): implications for macular degenerations. J Biol Chem. 2004;279:3046930473.[Abstract/Free Full Text]
- Marmorstein LY, Munier FL, Arsenijevic Y, et al. Aberrant accumulation of EFEMP1 underlies drusen formation in Malattia Leventinese and age-related macular degeneration. Proc Natl Acad Sci USA. 2002;99:1306713072.[Abstract/Free Full Text]
- Jacobson SG, Voigt WJ, Parel JM, et al. Automated light- and dark-adapted perimetry for evaluating retinitis pigmentosa. Ophthalmology. 1986;93:16041611.[Web of Science][Medline][Order article via Infotrieve]
- Steinmetz RL, Haimovici R, Jubb C, Fitzke FW, Bird AC. Symptomatic abnormalities of dark adaptation in patients with age-related Bruchs membrane change. Br J Ophthalmol. 1993;77:549554.[Abstract/Free Full Text]
- Alexander KR, Fishman GA. Prolonged rod dark adaptation in retinitis pigmentosa. Br J Ophthalmol. 1984;68:561569.[Abstract/Free Full Text]
- Chuang EL, Sharp DM, Fitzke FW, Kemp CM, Holden AL, Bird AC. Retinal dysfunction in central serous retinopathy. Eye. 1987;1:120125.[Web of Science][Medline][Order article via Infotrieve]
- Guymer RH, Gross-Jendroska M, Owens SL, Bird AC, Fitzke FW. Laser treatment in subjects with high-risk clinical features of age-related macular degeneration: posterior pole appearance and retinal function. Arch Ophthalmol. 1997;115:595603.[Abstract/Free Full Text]
- Fitzke FW, Kemp CM. Probing visual function with psychophysics and photochemistry. Eye. 1989;3:8489.[Web of Science][Medline][Order article via Infotrieve]
- Scholl HP, Bellmann C, Dandekar SS, Bird AC, Fitzke FW. Photopic and scotopic fine matrix mapping of retinal areas of increased fundus autofluorescence in patients with age-related maculopathy. Invest Ophthalmol Vis Sci. 2004;45:574583.[Abstract/Free Full Text]
- Piguet B, Haimovici R, Bird AC. Dominantly inherited drusen represent more than one disorder: a historical review. Eye. 1995;9:3441.[Web of Science][Medline][Order article via Infotrieve]
- Evans K, Gregory CY, Wijesuriya SD, et al. Assessment of the phenotypic range seen in Doyne honeycomb retinal dystrophy. Arch Ophthalmol. 1997;115:904910.[Abstract/Free Full Text]
- Pearce WG. Doynes honeycomb retinal degeneration: clinical and genetic features. Br J Ophthalmol. 1968;52:7378.[Free Full Text]
- Roybal CN, Marmorstein LY, Vander Jagt DL, Abcouwer SF. Aberrant accumulation of fibulin-3 in the endoplasmic reticulum leads to activation of the unfolded protein response and VEGF expression. Invest Ophthalmol Vis Sci. 2005;46:39733979.[Abstract/Free Full Text]
- von Rückmann A, Fitzke FW, Bird AC. Distribution of fundus autofluorescence with a scanning laser ophthalmoscope. Br J Ophthalmol. 1995;79:407412.[Abstract/Free Full Text]
- von Rückmann A, Fitzke FW, Bird AC. Distribution of pigment epithelium autofluorescence in retinal disease state recorded in vivo and its change over time. Graefes Arch Clin Exp Ophthalmol. 1999;237:19.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- von Rückmann A, Schmidt KG, Fitzke FW, Bird AC, Jacobi KW. Fundus autofluorescence in patients with hereditary macular dystrophies, Malattia Leventinese, familial dominant and aged-related drusen. Klin Monatsbl Augenheilkd. 1998;213:8186.[Medline][Order article via Infotrieve]
- von Rückmann A, Fitzke FW, Bird AC. Fundus autofluorescence in age related macular disease imaged with a scanning laser ophthalmoscope. Invest Ophthalmol Vis Sci. 1997;38:478486.[Abstract/Free Full Text]
- Lois N, Owens SL, Coco R, et al. Fundus autofluorescence in patients with age-related macular degeneration and high risk of visual loss. Am J Ophthalmol. 2002;133:341349.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Gaillard MC, Wolfensberger TJ, Uffer S, et al. Optical coherence tomography in Malattia Leventinese. Klin Monatsbl Augenheilkd. 2005;222:180185.[Medline][Order article via Infotrieve]
- Cideciyan AV, Swider M, Aleman TS, et al. ABCA4-associated retinal degenerations spare structure and function of the human parapapillary retina. Invest Ophthalmol Vis Sci. 2005;46:47394746.[Abstract/Free Full Text]
- Kelly SP, Thornton J, Lyratzopoulos G, Edwards R, Mitchell P. Smoking and blindness. BMJ. 2004;328:537538.[Free Full Text]
- Hageman GS, Anderson DH, Johnson LV, et al. A common haplotype in the complement regulatory gene factor H (HF1/CFH) predisposes individuals to age-related macular degeneration. Proc Natl Acad Sci USA. 2005;102:72277232.[Abstract/Free Full Text]
- Klein RJ, Zeiss C, Chew EY, et al. Complement factor H polymorphism in age-related macular degeneration. Science. 2005;308:385389.[Abstract/Free Full Text]
- Haines JL, Hauser MA, Schmidt S, et al. Complement factor H variant increases the risk of age-related macular degeneration. Science. 2005;308:419421.[Abstract/Free Full Text]
- Edwards AO, Ritter R, 3rd, Abel KJ, Manning A, Panhuysen C, Farrer LA. Complement factor H polymorphism and age-related macular degeneration. Science. 2005;308:421424.[Abstract/Free Full Text]
- Zareparsi S, Branham KE, Li M, et al. Strong association of the Y402H variant in complement factor H at 1q32 with susceptibility to age-related macular degeneration. Am J Hum Genet. 2005;77:149153.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Rivera A, Fisher SA, Fritsche LG, et al. Hypothetical LOC387715 is a second major susceptibility gene for age-related macular degeneration, contributing independently of complement factor H to disease risk. Hum Mol Genet. 2005;14:32273236.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
A G Robson, M Michaelides, V A Luong, G E Holder, A C Bird, A R Webster, A T Moore, and F W Fitzke
Functional correlates of fundus autofluorescence abnormalities in patients with RPGR or RIMS1 mutations causing cone or cone rod dystrophy
Br. J. Ophthalmol.,
January 1, 2008;
92(1):
95 - 102.
[Abstract]
[Full Text]
[PDF]
|
 |
|