|
|
||||||||
1From the Department of Dermatology, Massachusetts General Hospital, Boston, Massachusetts; and the 2Schepens Eye Research Institute, Boston, Massachusetts.
| Abstract |
|---|
|
|
|---|
METHODS. Serum-free medium was added to RPE eyecups (a healthy monolayer of RPE resting on choroid and sclera) and the supernatants were removed after 24 hours (RPE SN). The RPE SN was assayed for the presence of PEDF and SOM and for its ability to regulate interleukin (IL)-12, IL-10, and nitric oxide (NO) production by resting and activated macrophages. A group of mice received intradermal injection of lipopolysaccharide (LPS) and PEDF in one ear and LPS alone in the other ear. Ear thickness was measured before- and 24 hours after ear injections.
RESULTS. Soluble factors present in the RPE SN inhibited IL-12 production and substantially increased IL-10 while having minimal effects on NO production by activated macrophages. The message for PEDF, SOM, and IL-10 was detected in RPE cells, and the protein for these factors was found in the RPE SN. The stimulation of IL-10 and suppression of IL-12 production by RPE-SNtreated macrophages was neutralized by anti-PEDF antibodies. Neutralization of SOM in the RPE SN, suppressed NO production by activated macrophages. Intradermal injection of PEDF substantially inhibited LPS-induced inflammatory response.
CONCLUSIONS. PEDF inhibits LPS-driven macrophage activation in vitro and in vivo. By producing PEDF, the RPE contributes to innate immune privilege of the eye.
Adaptive immune privilege is well documented in all ocular compartments1 2 and is characterized by prolonged survival of allogeneic grafts, inhibition of the proinflammatory Th1 pathway and downregulation of complement-fixing antibodies, while at the same time, specifically produced cytotoxic T cells and noncomplement-fixing antibodies protect the eye from pathogenic damage.1 Existence of immune privilege to innate cells (innate immune privilege) has also been demonstrated recently in the anterior segment of the eye: Apte and Niederkorn3 showed that even though corneal endothelial cells are vulnerable to lysis by NK cells, aqueous humor inhibited their NK-mediated cytotoxicity; Chen et al.4 demonstrated that components of aqueous humor strongly inhibit CD95L-dependent activation of neutrophils; both TGF-ß2 and
-MSH constituents of aqueous humor inhibit neutrophil-mediated killing of corneal endothelial cells5 ; and suppression of NO production by macrophages has been demonstrated by calcitonin gene-related peptide in the aqueous humor6 ; and
-melanocyte stimulating hormone
-MSH in aqueous humor has been found to inhibit LPS-stimulated Toll-like receptor-4 signaling in macrophages.7
Although suppression of adaptive immunity in the subretinal space has been demonstrated previously, we now address whether the subretinal space suppresses innate immunity by investigating the effects of RPE eyecup supernatants (RPE SN) on the inflammatory activity on macrophages. The RPE are a monolayer of pigmented neuroepithelial cells that line the outermost boundary of the retina. The RPE monolayer is strategically placed, not only to act as the outer bloodretinal barrier, but also as an immunologic barrier by expressing cell surface molecules and secreting soluble mediators that influence the immune system.8
To evaluate the immunomodulatory properties of subretinal space, we used RPE eyecup cultures in which the RPE monolayer remains intact, resting on the choroid and the sclera.9 We used this technique to demonstrate that the RPE produces TGF-ß and thrombospondin to suppress Th1 cell activation and to promote systemic tolerance to antigens placed into the ocular microenvironment.10
Besides TGF-ß and thrombospondin and their suppressive activity on adaptive immunity, the RPE may also produce other immunosuppressive factors that affect innate immune activity. Two of these potential factors are pigment epithelium-derived factor (PEDF) and somatostatin (SOM). Recently, PEDF, secreted by the RPE into the interphotoreceptor matrix (subretinal space), has been shown to inhibit proliferation of innate immune cell such as macrophages.11 PEDF is a 50-kDa protein member of serine protease inhibitor family and is found in the RPE, ciliary body, and parts of the cornea and retina by immunofluorescence and Western blot analysis.12 PEDF is a potent antiangiogenic factor and can inhibit the growth of blood vessels in the eye.13 14 Both choroidal neovascularization and diabetic vitreoretinopathy have been associated with low levels of PEDF in the eye.15 16 Intravitreal injection of PEDF has also shown in a diabetic rat model to cause a decrease vascular permeability that correlated with reduction in levels of VEGF and its receptor, together with reduction in proinflammatory cytokines such as MCP-1, TNF-
, and ICAM-1.17
As well as being major mediators of inflammation, macrophages have been shown to be both anti-18 and proangiogenic.19 20 Thus, it is important to know the influence of PEDF on behavior of these innate immune cells. SOM, a neuropeptide present in aqueous humor, was reported to mediate the induction of regulatory T cells via production of
-MSH.21 Transcripts for SOM and its receptors have been reported to be present within the human retina and RPE.22
We examined whether RPE can release both PEDF and SOM and whether these factors contribute to the suppression of innate immunity in the subretinal space.
| Methods |
|---|
|
|
|---|
Preparation of RPE Eyecups
RPE eyecups were prepared as described previously.9 Briefly, enucleated eyes of C57BL/6 mice were placed in Ca2+-Mg2+free Hanks balanced sale solution (HBSS) on ice for 30 minutes. Subsequently, the anterior segment of the eye including the cornea, iris, ciliary body, and lens were excised with microscissors. The remaining tissue was placed in 0.01 U/mL of chondroitinase ABC (Sigma-Aldrich) for 30 minutes at 37°C, then placed on ice and washed three times in HBSS. The neural retina was gently lifted off the RPE layer with microsurgical forceps. Posterior eyecups consisting of sclera, choroid, and a healthy monolayer of RPE were placed in individual wells of a microculture plate (S plate; Nalge Nunc International, Naperville, IL) for 24 hours, diluted 1:10 and used for further experiments.
Cell Cultures
A mouse monocytic leukemia cell line, RAW 264.7, was obtained from ATCC (Manassas, VA) and grown in complete DMEM. In all experiments, 5 x 105 cells were incubated in each well of a 96-well plate (Fisher Scientific, Pittsburgh, PA) in serum-free medium, with or without the addition of lipopolysaccharide (LPS; Sigma-Aldrich), RPE SN, recombinant PEDF, SOM, or antibodies against PEDF and SOM. The cultures were incubated for 18 hours at 37°C. Subsequently, the culture supernatants were assayed for IL-10, IL-12, or nitric oxide.
IL-10 and IL-12 ELISA
The concentrations of IL-10 and IL-12 were assayed by using specific sandwich ELISAs (quantikine murine IL-10 and mouse IL-12p70; R&D Systems, Minneapolis, MN). In brief, samples and standard recombinant IL-10 or IL-12p70 were added to the wells of precoated 96-well plates and incubated for 2 hours at room temperature. The plates were washed and IL-10 or IL-12p70 antibody conjugates were added, incubated for 2 hours, and washed. Substrate solution was added to each well and incubated for 30 minutes at room temperature. The reaction was stopped by the addition of 1.0 N H2SO4. A plate reader (MicroQuant; Bio-Tek Instruments, Winooski, VT) was used to read the optical density of the color change at a wavelength of 450 nm. The concentration of cytokine in the sample was calculated from a standard based on the optical density of the curve made from the optical density versus the corresponding standard cytokine concentration run with the samples.
SOM ELISA
The concentration of SOM in the SN of the RPE eyecups was measured using a competitive ELISA method.21 A 96-well flat-bottomed plate (Corning-Costar, Corning, NY) was coated with 1: 500 dilution of anti-Rb IgG (Sigma-Aldrich) overnight. The plate was then blocked and incubated with a 1:400 dilution of anti-SOM antibody. RPE SN were mixed with 2 ng/mL of biotinylated SOM and added to the wells. To prepare the standard curve, known quantities of SOM protein (0.00310 ng/mL) were mixed with the biotinylated-SOM. The buffer to block, wash the wells, and dilute the antibodies was a 1% BSA (Sigma-Aldrich) solution in 0.1 M PBS (PBS-BSA). The plate was incubated for 2 hours at room temperature and washed. Diluted (1:1000) streptavidin-ß galactosidase (Invitrogen-Gibco, Gaithersburg, MD) was added to the wells, and the plate was incubated for 30 minutes at room temperature. After washing, the substrate chlorophenyl-red-ß-D-galactoside (Invitrogen-Gibco BRL) was added, and the optical density of the color change was read 1 hour later by a plate reader (MicroQuant; Bio-Tek Instruments). An equation fitted to the polynomial regression of known SOM concentrations was used to calculate the concentration of SOM in the SN of the RPE eyecup from the sample optical density. The sensitivity of the competitive ELISA was 3 pg/mL.
RNA Isolation
Total RNA was isolated from RPE cells harvested from eyecups and from the confluent second passage of cultured monodispersed RPE (RNA STAT-60 kit; Tel-Test, Inc., Friendswood, TX) according to the manufacturers instructions provided. This kit uses a single-step method by acid guanidinium thiocyanate-phenol-chloroform extraction.
Reverse TranscriptionPolymerase Chain Reaction
cDNA was synthesized by reverse transcribing RNA with random hexamers and AMV reverse transcriptase (Promega, Madison, WI). For PCR amplification of SOM F-ppSOM, TGG CTT TGG GCG GTG TCA, and R-ppSOM, CAG CCA GCT TTG CGT TCC (265 bp). Primers for GAPDH were, F-GAPH, GGTGAAGGTCGGTGTGAACGGA; R-GAPDH, TGTTAGTGGGGTCTCGCTCCTG (245 bp). PCR reactions were performed in a 50-µL amplification mixture containing 1x polymerase buffer, 2.5 mM MgCl2, 0.2 mM each dNTP, 1 µM of forward and reverse primers, 1.25 U Taq polymerase (Perkin Elmer, Wellesley, MA). The PCR thermal profile was performed in a thermal cycler (GeneAmp PCR System 2400; Perkin Elmer): 1 cycle for 5 minutes at 94°C and 5 minutes at 60°C; 40 cycles for 2 minutes at 72°C, 1 minute at 94°C, and 1 minute at 58°C; and 1 cycle, 10 minutes at 72°C, hold at 4°C. PCR products were then separated by 1.5% agarose gel electrophoresis.
Immunoblot
Recombinant PEDF protein (BioProducts Maryland, Inc., Middletown, MD) was used as a positive control. RPE SN (final dilution 1:20) and control samples (2.5 ng) were subjected to SDS-PAGE in 4% to 12% Bis-Tris gradient gels (Invitrogen Inc., Carlsbad, CA) followed by electrophoretic transfer of separated proteins to nitrocellulose membranes (Pierce, Rockford, IL). Immunoblot analysis was performed with anti-PEDF antibody (BioProducts Maryland, Inc.). Antibodies bound to proteins on the membrane were detected with horseradish peroxidaseconjugated secondary antibody (Santa Cruz Biotechnology, Santa Cruz, CA) and chemiluminescent substrate (ECL detection reagents; GE Healthcare, Piscataway, NJ). Membranes were then exposed to light film (Biomax Eastman Kodak, Rochester, NY) to detect the chemiluminescent signal.
Nitric Oxide Assay
Accumulation of nitrite in the culture supernatant of LPS-activated macrophages were assayed as an indicator of nitric oxide production. Macrophages, in phenol-free DMEM supplemented with 10% fetal bovine serum (Hyclone, Logan, UT), were placed in the wells of flat-bottomed 96-well plate at the concentration of 5 x 105 cells per well for 2 hours at 37°C. The culture media were replaced with 100 µL of phenol-redfree DMEM with 0.5% of FBS. Experimental wells contained 50 µL of 1 µg/mL of LPS and RPE SN. Some experimental wells also received 1 µg/mL of anti-PEDF or anti-SOM antibodies. Recombinant PEDF (250 ng/mL) or SOM (2 µg/mL) were added to some cultures, with or without LPS. The cultures were incubated for 18 hours at 37°C. The supernatants were assayed for NO by mixing 100 µL of supernatants with 100 µL Griess reagent (1% sulfanilamide-0.1% naphthylethylene diamine dihydrochloride in 2% H3PO4) in a 96-well plate. After 15 minutes of incubation at room temperature, the plate was read at 550 nm using the plate reader (MicroQuant; Bio-Tek Instruments). The concentration of nitrite in the culture supernatant was determined from a standard curve of known sodium nitrite concentrations (0.003100 µM).
Induction and Assessment of Endotoxin-Induced Inflammation
Groups of C57BL/6 mice (n = 5) received intradermal injections of LPS (1 µg/5 µL) together with 5 µL of recombinant PEDF (250 or 125 ng/mL) intradermally into the right ear pinnae. As a control, the mice received 1 µg of LPS in 10 µL in the left ear. Both ear pinnae were measured with an engineers micrometer (Mitutoyo, Tokyo, Japan) immediately before and 24 hours after the ear injection. The measurements were performed in triplicate. The suppression of inflammation was measured as the change in ear swelling (24-hour minus 0-hour measurement in the PEDF- and LPS-injected ear) relative to positive control animals (24-hour measurement minus 0-hour measurement in the LPS-injected ear). A two-tailed Students t-test was used, with significance assumed at P
0.05.
| Results |
|---|
|
|
|---|
RAW cell macrophages were either incubated alone, with LPS, or with RPE SN and LPS. Some cultures contained only the RPE SN. RPE SN did not contain any IL-12, but resting macrophages produced a background level of IL-12, which rose significantly in the presence of LPS (Fig. 1A) . Addition of RPE SN significantly inhibited IL-12 production by both resting and LPS-activated macrophages.
|
The effect of RPE SN on NO production was determined by coculturing RAW cell macrophages with LPS and RPE SN. Control cultures contained either macrophages alone or macrophages treated with LPS. As demonstrated in Figure 1C , untreated macrophages do not produce NO, but production of NO was significantly increased after treatment with LPS. The RPE SN contained a significant but small amount of NO, and macrophages treated with RPE SN, in presence of LPS, had a significant but modestly higher level of NO than with LPS alone (Fig. 1C) . These data demonstrate that soluble factors produced by RPE affect macrophage innate activity by inducing IL-10 and significantly inhibiting IL-12 production, while having a slight effect on NO generation.
Role of PEDF in IL-10 and IL-12 Production by Macrophages
It is known that PEDF is produced and secreted by RPE.24 To detect the presence of PEDF in our RPE SN, immunoblot assay for PEDF was performed. The results in Figure 2 show that there is a detectable amount of PEDF in the RPE SN in concentrations of 500 to 250 ng/mL.
|
|
Because IL-10 is known to have an inhibitory effect on IL-12 production by macrophages,25 we assayed for the possibility that PEDF suppression of IL-12 production is via PEDF-induced IL-10 in the macrophages. The anti-IL-10 antibody was added to cultures of LPS-stimulated macrophages treated with RPE SN. As before, addition of either RPE SN or PEDF to LPS-stimulated macrophage cultures suppressed IL-12 production (Fig. 4) . The neutralization of IL-10 with anti-IL-10 antibody significantly increased IL-12 production by the RPE-SNtreated macrophages (Fig. 4) . Similarly, neutralization of IL-10 in the cultures of LPS-stimulated macrophages treated with recombinant PEDF blocked PEDF inhibition of IL-12 production. The data demonstrate that PEDF indirectly suppresses IL-12 secretion by stimulating an immunosuppressive autocrine pathway of IL-10 production by macrophages.
|
|
|
|
| Discussion |
|---|
|
|
|---|
The finding that RPE can stimulate IL-10 production by macrophages is important, because the immunoregulatory activity of IL-10 is very similar to the ocular factors that mediate immune privilege in the eye. IL-10 inhibits the central proinflammatory transcription factor NF
B in macrophages and CD4+ T cells. In contrast, IL-10 promotes activation and migration of CD8+ cytotoxic T cells and may mediate the induction of regulatory T cells.28 29 30 31 In dendritic cells, IL-10 inhibits expression of class II major histocompatibility complex (MHC) molecules32 and the CD28 costimulatory pathway of T-cell activation,33 while promoting production of TGF-ß,34 a well-known anti-inflammatory cytokine. Therefore, the induction of IL-10 further promotes the mechanisms of immune privilege to suppress the induction of inflammation by innate and adaptive immunity.
Our results are the first to demonstrate SOM production by murine RPE and that the role of SOM in suppressing innate immunity is different from its role in aqueous humor suppression of Th1 cells. Although SOM alone does not induce NO production by macrophages and does not suppress NO production by LPS-stimulated macrophages, its presence prevented RPE SN suppression of NO production by LPS-stimulated macrophages. We demonstrated that PEDF, another factor in RPE SN, inhibits NO production by LPS-stimulated macrophages, and only when SOM was neutralized in the RPE SN was there suppression of NO production. It appears that PEDF and SOM are antagonistic to each other in regulating LPS-stimulated NO production.
Although our results suggest that NO generation by macrophages cannot be suppressed in the subretinal space by the RPE, there is a possibility that NO functions in the subretinal space as an immunosuppressive factor. There is a delicate balance between NO proinflammatory and immunosuppressive affects. How this balance is regulated in the eye is unknown; however, there is evidence that NO may play a beneficial role in immune privilege of the subretinal space. RPE cells from rats cocultured with activated lymphocytes produce high amounts of NO that are cytotoxic to the lymphocytes.23 In addition, Zech et al.35 demonstrated that NO elevates transepithelial electrical resistance (TER), thus promoting the integrity of the tight junctions between the RPE cells and strengthening the ocular outer bloodretinal barrier. These reports indicate that NO has a beneficial role in maintaining the immune privilege of the subretinal space.
The PEDF induction of IL-10 by macrophages may well be an example of the evolutionary adaptation of the eye to mediate immune privilege with factors that have functions that are necessary for ocular physiology. The most well-understood action of PEDF is its antiangiogenic activity. PEDF inhibits endothelial cell migration in response to a diverse group of proangiogenic factors36 and augments endothelial cell expression of FasL, leading to selective apoptosis of endothelial cells involved in angiogenesis.37 Also, PEDF downregulates nuclear factor of activated T cells (NFAT), an essential transcription factor for vascular epithelial growth factor (VEGF) induction of angiogenesis.38 In addition, PEDF could render some of its antiangiogenic activity through induction of IL-10 in macrophages. It has been reported that IL-10 is antiangiogenic by its ability to decrease VEGF, TNF-a, or MMP-9 synthesis in a rabbit corneal angiogenesis model, and in mice hindlimb ischemia-induced angiogenesis.39 40 41 A recent study has also linked the antiangiogenic function of PEDF with its ability to decrease proinflammatory factors such as TNF-
, ICAM-1, and MCP-1.17
To test the effect of PEDF on macrophages in vivo, we injected LPS into the left ear pinnae of a group of mice, whereas the other ear received LPS and PEDF. LPS induces macrophage activation, which in turn produce PMNL infiltration.27 We have demonstrated that PEDF substantially inhibited the inflammation induced by LPS in vivo. In a previous report, we noted that RPE-produced thrombospondin-1 is a potent immunosuppressive factor in the subretinal space by activation of TGF-ß and inhibition of Th1 activation.9 In the present study, by production of PEDF, RPE profoundly inhibited proinflammatory activity of macrophages. This action of PEDF was also demonstrated in an in vivo model of LPS-induced inflammation. Our results further contribute to defining immune privilege within the ocular microenvironment to be the suppression of inflammation mediated by both innate and adaptive immunity.
| Footnotes |
|---|
Supported in part by National Eye Institute Grant EY05678 and Grant 04037006 from the Department of Defense.
Submitted for publication September 26, 2005; revised February 24 and April 17, 2006; accepted June 23, 2006.
Disclosure: P. Zamiri, None; S. Masli, None; J.W. Streilein, None; A.W. Taylor, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: Parisa Zamiri, Wellman Center for Photomedicine, Department of Advanced Microscopy, Bartlett Extension 630, 55 Fruit Street, Boston, MA 02114; pzamiri{at}partners.org.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Wang, J. J. Wang, J. Li, K. Park, X. Qian, J.-x. Ma, and S. X. Zhang Pigment epithelium-derived factor suppresses adipogenesis via inhibition of the MAPK/ERK pathway in 3T3-L1 preadipocytes Am J Physiol Endocrinol Metab, December 1, 2009; 297(6): E1378 - E1387. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Zhang, Y. Hu, and J.-x. Ma Anti-inflammatory and Antioxidant Effects of SERPINA3K in the Retina Invest. Ophthalmol. Vis. Sci., August 1, 2009; 50(8): 3943 - 3952. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Wang, S.-J. Lin, Y.-H. Chen, F.-Y. Lin, J.-C. Shih, C.-C. Wu, H.-L. Wu, and Y.-L. Chen Late Outgrowth Endothelial Cells Derived From Wharton Jelly in Human Umbilical Cord Reduce Neointimal Formation After Vascular Injury: Involvement of Pigment Epithelium-Derived Factor Arterioscler Thromb Vasc Biol, June 1, 2009; 29(6): 816 - 822. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Qiao, K. Lucas, and J. Stein-Streilein Retinal Laser Burn Disrupts Immune Privilege in the Eye Am. J. Pathol., February 1, 2009; 174(2): 414 - 422. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. X Zhang, J. J Wang, A. Dashti, K. Wilson, M.-H. Zou, L. Szweda, J.-X. Ma, and T. J Lyons Pigment epithelium-derived factor mitigates inflammation and oxidative stress in retinal pericytes exposed to oxidized low-density lipoprotein J. Mol. Endocrinol., September 1, 2008; 41(3): 135 - 143. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Qin, M. Ni, and G. W. De Vries Implication of S-Adenosylhomocysteine Hydrolase in Inhibition of TNF-{alpha}- and IL-1{beta}-Induced Expression of Inflammatory Mediators by AICAR in RPE Cells Invest. Ophthalmol. Vis. Sci., March 1, 2008; 49(3): 1274 - 1281. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yoshida, S.-i. Yamagishi, T. Matsui, K. Nakamura, T. Imaizumi, K. Yoshimura, and R. Yamakawa Positive correlation of pigment epithelium-derived factor and total antioxidant capacity in aqueous humour of patients with uveitis and proliferative diabetic retinopathy Br J Ophthalmol, September 1, 2007; 91(9): 1133 - 1134. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Futagami, S. Sugita, J. Vega, K. Ishida, H. Takase, K. Maruyama, H. Aburatani, and M. Mochizuki Role of Thrombospondin-1 in T Cell Response to Ocular Pigment Epithelial Cells J. Immunol., June 1, 2007; 178(11): 6994 - 7005. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |