IOVS Molecular Human Reproduction
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2007;48:1191-1200.)
© 2007 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.06-0296

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wordinger, R. J.
Right arrow Articles by Clark, A. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wordinger, R. J.
Right arrow Articles by Clark, A. F.

Effects of TGF-ß2, BMP-4, and Gremlin in the Trabecular Meshwork: Implications for Glaucoma

Robert J. Wordinger,1,2 Debra L. Fleenor,2,3 Peggy E. Hellberg,3 Iok-Hou Pang,1,3 Tara O. Tovar,1 Gulab S. Zode,1 John A. Fuller,1 and Abbot F. Clark1,3

1From the Department of Cell Biology and Genetics, University of North Texas Health Science Center at Fort Worth, Fort Worth, Texas; and 3Glaucoma Research, Alcon Research, Ltd., Fort Worth, Texas.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. The primary causative factor of primary open-angle glaucoma (POAG) is elevated intraocular pressure (IOP) due to increased aqueous humor (AH) outflow resistance, which is associated with morphologic and biochemical changes in the trabecular meshwork (TM). Patients with glaucoma have elevated levels of transforming growth factor (TGF)-ß2 in their AH, and TGF-ß has been shown to increase TM extracellular matrix (ECM) production. The bone morphogenetic protein (BMP) signaling pathway modifies TGF-ß signaling in several different tissues, and a prior study demonstrated that TM cells and tissues express members of the BMP gene family. The purpose of this study was to determine whether BMPs can alter TGF-ß2 signaling in the TM and whether there are defects in BMP signaling in glaucoma.

METHODS. ELISA, Western immunoblot analysis, and immunohistochemistry were used to evaluate the expression of BMP proteins in TM cells and tissues. ELISA was used to determine the effects of TGF-ß2 and BMPs on TM fibronectin (FN) secretion. Gene expression was determined by gene microarrays and quantitative (q)PCR. Perfusion-cultured human anterior segments were used to study the effects of altered BMP signaling on IOP.

RESULTS. The human TM synthesized and secreted BMP-4 as well as expressed BMP receptor subtypes BMPRI and BMPRII. TM cells responded to exogenous BMP-4 by phosphorylating Smad signaling proteins. Cultured human TM cells treated with TGF-ß2 significantly increased FN levels, and BMP-4 blocked this FN induction. The expression of BMP family genes in normal and glaucomatous TM cells was profiled and significant elevation of mRNA and protein levels of the BMP antagonist gremlin were found in glaucomatous TM cells. In addition, Gremlin was present in human aqueous humor and in the perfusate medium of perfusion-cultured human eyes. Gremlin blocked the negative effect of BMP-4 on TGF-ß-induction of FN. Recombinant Gremlin added to the medium of ex vivo perfusion-cultured human eye anterior segments caused the glaucoma phenotype of elevated IOP.

CONCLUSIONS. These results are consistent with the hypothesis that, in POAG, elevated expression of Gremlin by TM cells inhibits BMP-4 antagonism of TGF-ß2 and leads to increased ECM deposition and elevated IOP.


Glaucoma is a major cause of irreversible blindness, affecting more than 70 million individuals worldwide.1 Elevated intraocular pressure (IOP) is a major risk factor in the development of glaucoma2 and in the progression of glaucomatous damage.3 Elevated IOP is due to increased aqueous humor (AH) outflow resistance4 and appears to be associated with several morphologic and biochemical changes in the trabecular meshwork (TM). Very little is understood about the regulation of TM function, including the pathogenic causes of increased outflow resistance in the glaucomatous TM. However, there is an accumulation of extracellular matrix (ECM) material in the glaucomatous TM,4 5 and this increase may be due to disruption of the normal balance between ECM deposition and degradation.

Growth factors present in the AH bathing the TM could shift this balance, resulting in the accumulation of ECM, increased outflow resistance, and, ultimately, elevated IOP. For example, recent reports indicate that transforming growth factor (TGF)-ß2 is involved in the pathogenesis of primary open-angle glaucoma (POAG).6 Initially, TGF-ß2 was reported to be elevated in the AH of eyes with POAG.7 8 9 These initial reports were followed by studies demonstrating that TGF-ß2 acts via multiple pathways within the human TM, resulting in increased ECM deposition and cross-linking that impede degradation. For example, exogenous TGF-ß2 (1) increases in vitro synthesis of ECM molecules in cultured TM cells10 and within the perfused anterior eye organ culture model,11 (2) increases expression of plasminogen activator inhibitor (PAI)-1 and prevents activation of matrix metalloproteinases via tissue plasminogen activator (tPA) and/or urokinase (uPA),12 (3) increases irreversible cross-linking of ECM components by TM cells via tissue transglutaminase,10 and (4) inhibits TM cell proliferation.13

However, within a given tissue, the actions of most growth factors are often counterbalanced by other growth factors, so that, normally, only small spatial and temporal changes occur in structure and function. The bone morphogenetic proteins (BMP) are members of the TGF-ß superfamily of growth factors. Originally identified as osteoinductive cytokines that promote bone and cartilage formation,14 BMPs are now known to control multiple functions in a variety of cell types.15 A combination of intracellular and extracellular antagonists tightly control the biological activity of BMPs. Recently, a group of unique but structurally related secreted BMP antagonists have been identified.16 Examples of secreted BMP antagonists include noggin, chordin, follistatin, and members of the DAN (differential screening-selected gene and members aberrative in neuroblastoma) family including cerberus, caronte, and Drm/Gremlin (down-regulated by mos; CKTSF1B1). The mechanism of inhibition appears to be direct binding to BMP by these antagonists, thus preventing BMP from interacting with the receptor complex.15 Drm/Gremlin is a member of the DAN/cerberus family of BMP antagonists and is a highly conserved 20.7-kDa glycoprotein.17 The Drm gene was isolated during a screening of a transformation-resistant v-mos-transformed rat fibroblast.18 The Xenopus homologue to drm was designated gremlin.17 Gremlin heterodimerizes with BMP-2, -4, and -7 to prevent functional activity. Previous reports suggest that BMP antagonists likely play an important role in regulating multiple cell functions both during early development and in adult tissues.19

We have shown that human TM cells express BMPs, BMP receptors and mRNA for selective BMP antagonists.20 The present study demonstrates that TM cells are capable of secreting BMPs and that BMP-4 selectively counteracts the effect of TGF-ß2 in TM cells with respect to ECM-related proteins. It appears that BMP-4 plays a significant role in maintaining the normal function of the TM by modifying the action of TGF-ß2. In addition, we demonstrate that the BMP antagonist Gremlin inhibits BMP-4 activity in cultured TM cells and increases outflow resistance in a perfusion cultured human eye anterior segment model. Significantly, we demonstrate that levels of both Gremlin mRNA and protein are elevated in glaucomatous human TM cell lines. We propose that, in POAG, elevated Gremlin expression by TM cells inhibits BMP-4 regulation of TGF-ß2 effects, leading to increased ECM deposition and elevated IOP.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
TM Cell Culture
Human TM cells were isolated from carefully dissected human TM tissue explants derived from patients with glaucoma (GTM) or nonglaucomatous donors (NTM) and characterized as previously described.13 21 22 23 24 25 26 All donor tissues were obtained and managed according to the guidelines in the Declaration of Helsinki for research involving human tissue. Glaucoma donor history consisted of a diagnosis of open-angle glaucoma, glaucoma therapy, and documented glaucomatous visual field defects. The culture and characterization of a transformed TM cell line (GTM-3) has been described.27 Isolated TM cells were grown in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen-Gibco, Grand Island, NY) containing 10% fetal bovine serum (HyClone, Logan, UT) and 50 µg/mL gentamicin (Invitrogen-Gibco). We chose to perform most of our experiments in serum-free medium, to allow us to dissect the independent effects of TGF-ß2, BMP-4, and Gremlin. We have shown that TM cells make and respond to a variety of growth factors,13 and that serum greatly complicates the interpretation of results because of the presence of binding proteins, proteinases, and various levels of growth factors (including TGF-ß). Also, TM cells are grown in FBS to allow them to proliferate, but they are in low serum (low protein) conditions in situ.

Immunohistochemistry of BMP Receptors in TM Tissues
Three sets of normal and three sets of glaucomatous human donor eyes were obtained from regional eye banks within 6 hours of death and fixed in 10% formalin. Fixed tissues were dehydrated, embedded in paraffin, and cut in 8-µm sagittal sections that were placed on microscope slides (Probe On Plus; Fisher Scientific, Hampton, NH). Sections were deparaffinized and rehydrated before placement in 0.1% Triton, followed by 0.02 M glycine for 15 minutes each. Nonspecific staining was blocked by a 30-minute incubation in 10% normal serum. Sections were washed briefly and treated with primary anti-BMP-receptor antibodies (R&D Systems, Inc., Minneapolis, MN) or nonimmune serum (negative controls) diluted 1:100 in 1.5% normal serum for 1 hour at room temperature. These antibodies were previously characterized by Western blot analysis of TM cells and tissues.20 After three washes in PBS, sections were incubated with appropriate secondary antibodies (Alexa Fluor 488; Invitrogen-Molecular Probes, Carlsbad, CA) for 45 minutes. Sections were treated with 4',6'-diamino-2-phenylindole (DAPI) nuclear stain, washed, and mounted.

Western Blot Analysis
Secreted BMP.
BMP secretion by TM cell lines was determined by Western immunoblot analysis. Conditioned medium was collected from normal and glaucomatous human TM cells after a 48-hour treatment with serum-free medium containing 0.5 mg/mL BSA. Proteins were separated on a 12% denaturing polyacrylamide gel and transferred by electrophoresis to a nitrocellulose membrane. Nonspecific binding was blocked by soaking membranes in 1x TBS, 5% powdered milk, and 0.05% Tween-20 for at least 15 minutes at room temperature. Mouse anti-BMP-4 monoclonal primary antibody (Mab757, 1 µg/mL; R&D Systems) was used. The secondary antibody consisted of goat anti-mouse polyclonal antibody (sc-2005; Santa Cruz Biotechnology, Santa Cruz, CA).

Cell Lysates.
Cell lysates were used for both phosphorylated and nonphosphorylated Smad signaling proteins. Confluent normal TM and glaucomatous TM cells (2 x 107) were collected in 1.0 mL of mammalian protein extraction buffer (78501) and protease inhibitor cocktail (78415; both from Pierce Biotechnology, Inc., Rockford, IL). Protein concentration was determined by the Bradford method. Lysates (40–60 µg) were mixed with an equal volume of electrophoresis buffer and boiled for 90 seconds. Proteins were separated on a 12% denaturing polyacrylamide gel and transferred by electrophoresis to a nitrocellulose membrane. Nonspecific binding was blocked by soaking membranes in 1x TBS, 5% powdered milk, and 0.05% Tween-20 for at least 15 minutes at room temperature. Membranes were incubated with the following primary antibodies for 45 minutes: nonphosphorylated Smad1 (9512 at 1:500; Cell Signaling Technology, Beverly, MA), Smad4 (MAB1132 at 1 µg/mL; Chemicon International, Temecula, CA), Smad 5 (51-3700 at 1:1000; Zymed, San Francisco, CA), Smad6 (51-0900 at 1 µg/mL; Zymed); phosphorylated pSmad1 (566411 at 1 mg/mL; Calbiochem, La Jolla, CA), pSmad1-5-8 (AB3848 at 1:500; Chemicon International); and Gremlin (AP6133a at 0.5 µg/mL; Abgent, San Diego, CA). After the membranes were washed three times with TBS plus 0.05% Tween-20 for 30 minutes, they were incubated with horseradish peroxidase (HRP)-conjugated secondary goat anti-rabbit antibody (2030; Santa Cruz Biotechnology) diluted 1:500 to 1:5000, followed by three washes with TBS plus 0.05% Tween-20 and one wash in TBS alone. Detection was performed with chemiluminescence detection reagents (ECL; GE Healthcare, Piscataway, NJ). Blots were exposed to autoradiograph film (Hyperfilm-ECL; GE Healthcare) for 1 minute to 1 hour, depending on the amount of target protein present. Electrophoresis buffer alone and neutralization of primary antibodies by control peptides served as negative controls. Primary antibodies were neutralized with a 10-fold (by weight) excess of control peptide in PBS overnight at 4°C. Western blot analysis for each protein was repeated twice, to confirm the results.

Gremlin Protein Expression
Gremlin protein expression was determined in TM cell lysates, TM tissue lysates, human AH (obtained after informed consent from normal patients undergoing cataract surgery), and perfusate medium from perfusion-cultured human eyes by Western immunoblot analysis, as just described.

ELISA Assay for Fibronectin
Cultured normal and glaucomatous human TM cells were treated with commercially available recombinant BMP-4 (0–100 ng/mL; 314-BP; R&D Systems) and/or TGF-ß2 (5 ng/mL; Sigma-Aldrich, St. Louis, MO) for 24 hours. Conditioned medium was evaluated for BMP’s effects on fibronectin production using a commercially available ELISA kit (AssayMax; AssayPro LLC, Winfield, MO). We had already demonstrated that treatment of cultured human TM cells with TGF-ß2 significantly increases fibronectin levels in the culture medium.28

Gene Analysis of Normal and Glaucomatous Trabecular Meshwork Cells
Total RNA was isolated from four normal TM cell lines and four glaucomatous TM cell lines. Aliquots of normal TM RNA and glaucomatous TM RNA were each pooled. Total RNA from normal and glaucomatous TM cells were reverse transcribed, and second-strand cDNA synthesis and biotin-labeled amplified RNA were performed according to standard procedures. Human genome gene chips (U133Plus2; Affymetrix Inc., Santa Clara, CA) were hybridized, washed, and scanned (Gene Array scanner; Agilent Technologies, Englewood, CO), and raw data were collected and analyzed (Microarray Suite; Affymetrix). Only genes flagged as "present" on the gene chip were analyzed.

Quantitative PCR
Real-time PCR was performed (Mx3000P Real-Time System; Stratagene La Jolla, CA) with PCR master mix (SYBR Green; Stratagene). Each reaction contained 12.5 µL of 2x master mix, 500 nM Gremlin forward and reverse primers, and 2.5 ng cDNA from well-established, normal (n = 5) or glaucomatous (n = 6) TM cell lines. PCR primers were designed with the Primer3 design program (Whitehead Institute; MIT, Cambridge, MA) to span an exon–intron boundary and tested negative for genomic DNA amplification with the in silico PCR program (University of California, Santa Cruz): Gremlin 5': GTCACACTCAACTGCCCTGA, Gremlin 3': ATGCAACGACACTGCTTCAC, product size: 77 bp; and TBP 5': GAAACGCCGAATATAATCCCA, TBP 3': GCTGGAAAACCCAACTTCTG, product size: 181 bp.

Cycle threshold (Ct) values were normalized to the housekeeper TATA binding protein (TBP) and were analyzed (MxPro software; Stratagene). Standard curves for Gremlin and TBP were >0.994. Comparative quantification was performed based on the {Delta}{Delta}Ct method. Statistical analysis was performed using an unpaired two-tailed Student’s t-test assuming unequal variances.

Human Eye Anterior Segment Perfusion Organ Culture Model
Human ocular perfusion organ culture was performed as described.24 25 29 30 31 32 33 Human donor eyes (with an average age of 81.9 ± 10.9 years; age range, 56–96 years), none of which were known to have glaucoma, were obtained at 16 to 20 hours after death and dissected at the equator, and the iris, lens, most of the ciliary body, and vitreous were removed. The anterior segment of the eye, including cornea and sclera ring containing the TM, was placed in a custom-made Plexiglas culture dish and sealed in place with a Plexiglas O-ring. DMEM was perfused through a central cannula in the bottom of the dish at a flow rate of 2.5 µL/min with a perfusion pump (Harvard Apparatus, South Natick, MA). The IOP was monitored via a second cannula attached to a pressure transducer (model P23XL; GE Healthcare). The IOP was recorded every 5 minutes, and hourly averages were calculated.

The anterior segment, cultured at 37°C in 5% CO2, was allowed to equilibrate for 2 to 4 days before the start of the study. Tissues that did not reach a stable IOP baseline were discarded (~40% of the eyes). Acceptable tissues were perfused with medium containing recombinant mouse Gremlin (10 µg/mL; R&D Systems) for 2 to 4 days. At the end of each study, the tissues were perfusion fixed at 15 mm Hg constant pressure, dissected into four quadrants, and processed for light microscopy and transmission electron microscopy, as previously described.24 30 31 32 33 The viability of the outflow pathway tissue, especially the TM, was evaluated in a masked fashion. Studies were regarded as invalid and the data discarded if more than one quadrant per eye had unacceptable morphologic findings such as: excessive TM cell loss, denudation of trabecular beams, an excess in cellular debris in the TM region, loss of Schlemm’s canal endothelial cells, or breaks in the Schlemm’s canal inner wall lining. Based on these criteria, none of the perfused tissues were rejected in the study.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Western Blot Analysis of Secreted BMP-4 by Human TM Cells
In order for BMPs to counterbalance the effects of TGF-ß2 within the human TM, secretion of BMPs by TM cells would be required. Normal TM cells were cultured for 48 hours in serum-free medium, and the medium was concentrated 10-fold before analysis. Western immunoblot analysis showed that normal TM cell lines secrete BMP-4 (Fig. 1) .


Figure 1
View larger version (36K):
[in this window]
[in a new window]

 
FIGURE 1. Western blot analysis of BMP-4 secreted by human TM cells. Three NTM cell lines were grown in serum-free DMEM for 48 hours, and the culture medium was analyzed for BMP protein expression by Western immunoblot analysis.

 
Immunohistochemical Localization of BMP Receptors in Human TM Tissue
We examined the expression of BMP receptor subtypes BMPRIa, BMPRIb, and BMPRII in three normal and three glaucomatous TM tissues from human donors. Each of the three BMP receptors was present in normal and glaucomatous human TM tissue, and there were no obvious differences between normal and glaucomatous donor eyes (Fig. 2) . Human TM cells should therefore be capable of responding to BMPs in the AH (e.g., paracrine signaling) and/or to BMPs secreted directly by TM itself (e.g., autocrine signaling), because they express BMP receptors.


Figure 2
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 2. Immunohistochemical localization of BMP receptors in human TM tissue. Normal human eyes were fixed, sectioned, and stained with antibodies for BMP receptors Ia, Ib, and II. Slides incubated in PBS-BSA without primary antibody or with nonimmune control IgG were used as negative controls. Human TM tissues stained positive for BMPR-Ia, BMPR-Ib, and BMPR-II, indicating that in vivo TM tissues express BMP receptors.

 
Western Blot Analysis of Smad Proteins in Human TM Cells
The canonical downstream signaling pathway for BMPs utilizes intracellular Smad proteins, so we examined the expression of receptor Smad (R-Smad1, R-Smad5) and co-Smad (Co-Smad4) proteins in human TM cells. R-Smad1, R-Smad5, and Co-Smad4 proteins were present in both normal and glaucomatous human TM cells (Fig. 3) . A major difference in protein levels was not apparent between normal and glaucomatous TM cell lines. These data indicate that human TM cells should be capable of responding to BMPs via the Smad signaling pathway.


Figure 3
View larger version (46K):
[in this window]
[in a new window]

 
FIGURE 3. Western blot analysis of Smad proteins in normal and glaucomatous human TM cells. Proteins from two NTM and two GTM cell lysates were separated by polyacrylamide gel electrophoresis followed by Western immunoblot analysis. Both NTM and GTM cells expressed intermediates of the canonical Smad signaling pathway, including receptor Smad1 and Smad5, and Co-Smad4. ß-Actin was included as a loading control.

 
Effect of Exogenous BMP-4 on Phosphorylated Receptor Smad Proteins Expressed in Human TM Cells
We had shown that TM cells express BMP receptors and contain Smad signaling proteins, so we next sought to determine whether exogenous BMP activates Smad signaling in cultured TM cells. Binding of BMPs to the BMPRI/BMPRII receptor complex initiated downstream signaling via phosphorylation of receptor Smads. Treating human TM cells with BMP-4 increased phosphorylated Smad1-5-8 protein (Fig. 4) , with protein levels that were increased by 60 minutes and then declined over 24 hours. Therefore, human TM cells are capable of responding to BMPs via phosphorylation of receptor Smads, indicating that the canonical Smad signaling pathway can be activated via exogenous BMPs.


Figure 4
View larger version (37K):
[in this window]
[in a new window]

 
FIGURE 4. Effect of exogenous BMP-4 on Smad protein phosphorylation. Human TM cells were exposed to exogenous BMP-4 (10 ng/mL) for various times (0, 5, 15, 30, or 60 minutes, or 24 hours) and compared to the vehicle control. Total and phosphorylated protein for pSmad1, total Smad5, and pSmad1-5-8 was measured by Western blot. ß-Actin was included as a loading control.

 
Effect of BMP-4 on TGF-ß2 Stimulation of Fibronectin Secretion by Normal and Glaucomatous Human TM Cell Lines
ECM metabolism in the TM is altered by TGF-ß.11 12 We have shown that TGF-ß2 increased fibronectin (FN) content in the medium of cultured TM cells.28 Previous studies have demonstrated that BMPs can modify TGF-ß signaling pathways,34 35 and so we tested whether BMP-4 regulates TGF-ß2-induced FN secretion by TM cells. Exogenous TGF-ß2 (5 ng/mL) increased FN secretion in both normal and glaucomatous TM cell lines (Table 1 ; Fig. 5A ). Overall, exposure of TM cell lines to exogenous BMP-4 (10 ng/mL) alone did not alter FN secretion when compared with vehicle control. However, BMP-4 significantly reduced the TGF-ß2-stimulated secretion of FN (Table 1 , Fig. 5A ). This effect of BMP-4 on TGF-ß2-induced fibronectin secretion was dose dependent (Fig. 5B) .


View this table:
[in this window]
[in a new window]

 
TABLE 1. Effect of BMP4, TGF-ß2, and Gremlin on TM Cell Fibronectin

 

Figure 5
View larger version (20K):
[in this window]
[in a new window]

 
FIGURE 5. Effect of BMP-4 on TGF-ß2 stimulation of FN content in culture medium of normal and glaucomatous human TM cell lines. (A) Two NTM and three GTM cell lines were treated for 24 hours, and FN levels in the culture medium were assayed by ELISA. TGF-ß2 alone (5 ng/mL) caused a significant increase in FN secretion by all cell lines (P < 0.05). BMP-4 alone (10 ng/mL) had no significant effect on FN secretion. However, a combination of TGF-ß2 and BMP-4 caused a significant reduction in TGF-ß2-stimulated FN secretion (P < 0.05). Mean ± SEM; P determined by one-way ANOVA with the Dunnett test. (B) GTM3 cells were exposed to various concentrations of BMP-4 (pg/mL) in combination with TGF-ß2 (5 ng/mL). BMP-4 dose-dependently inhibited TGF-ß2 stimulation of FN secretion by these cells.

 
Expression of Gremlin mRNA and Protein in Glaucomatous Human TM Cell Lines
We have shown that human TM cells and tissues express the mRNA of four BMPs, all three BMP receptors, and several BMP antagonists, including Gremlin.20 To examine whether defects in BMP signaling could be responsible for the elevated IOP associated with glaucoma, we compared the expression of genes involved in BMP signaling pathways in normal and glaucomatous TM cells. Messenger RNA from four normal and four glaucomatous TM cell lines was pooled, and gene expression was profiled by using gene chips (Affymetrix). Gremlin was expressed 16-fold higher in the pooled glaucomatous TM cell lines in comparison to the pooled normal TM cell lines. Increased expression of Gremlin in glaucomatous TM cells was confirmed by quantitative (q)PCR. Gremlin mRNA expression was 11.6-fold higher in GTM than in NTM cells (P = 0.05). Cell lysates from both normal and glaucomatous cell lines were examined for Gremlin protein via Western immunoblot analysis to confirm these Gremlin mRNA results. Gremlin was present as a doublet at approximately 25 to 28 kDa (Fig. 6B) as previously described.18 Gremlin protein levels were significantly higher in glaucomatous TM cell lines compared with the normal TM cell lines (P = 0.029; Figs. 6B 6C ).


Figure 6
View larger version (27K):
[in this window]
[in a new window]

 
FIGURE 6. Expression of Gremlin mRNA and protein in normal and glaucomatous human TM cells. (A) qPCR of Gremlin mRNA in NTM (n = 5) and GTM (n = 6) cells. Gremlin mRNA expression was increased 11.6-fold in GTM cells (P = 0.05). (B) Western blot analysis for Gremlin in four NTM and five GTM cell lines. (C) GTM cells had significantly elevated levels of Gremlin protein (P = 0.029). (D) Gremlin Western immunoblot analysis of human AH samples (AQ), human TM tissue, and perfusate medium for perfusion organ-cultured human eyes (POC).

 
Expression of Gremlin in TM Tissue, Human AH, and Perfusates of Cultured Human Anterior Segments
To determine whether Gremlin is also expressed in vivo, Gremlin Western immunoblots were performed on lysates of TM tissue, human AH, and perfusate medium from perfusion-cultured human anterior segments (Fig. 6D) . Gremlin was present as a doublet in AH and perfusate medium (Fig. 6D) , similar to that in cultured TM cell lysates (Fig. 6B) . However, the lysate of TM tissue appeared to have several additional bands, including a major higher-molecular-weight band, which may be a proform of Gremlin.

Gremlin Antagonized the BMP-4 Inhibition of TGFß-2-Stimulated Fibronectin Secretion by Human TM Cells
Increased expression of Gremlin in glaucomatous TM cells could possibly antagonize the positive effect of BMP-4 in blocking TGF-ß2 induction of FN in TM cells. We evaluated the effect of Gremlin on the regulation of FN in TM cells by TGF-ß2 and BMP-4. TGF-ß2 caused a threefold increase in fibronectin secretion when compared with untreated TM cells (P < 0.05), whereas a combination of TGF-ß2 and BMP-4 inhibited fibronectin secretion (P < 0.05; Fig. 7 , Table 1 ). Gremlin antagonized the inhibitory action of BMP-4 on fibronectin secretion, restoring FN levels to those of TGF-ß2 alone.


Figure 7
View larger version (12K):
[in this window]
[in a new window]

 
FIGURE 7. Effect of Gremlin on BMP-4 inhibition of TGF-ß2 induced FN secretion by human TM cells. GTM-3 cells were treated for 24 hours with TGF-ß2 alone (5 ng/mL); TGF-ß2 and BMP-4 (1 ng/mL); or TGF-ß2, BMP-4, and Gremlin (10 µg/mL). Untreated cells served as a control. FN levels were determined by ELISA immunoassay. BMP-4 significantly inhibited TGF-ß2 stimulation of FN (*P < 0.05 vs. vehicle control group by one-way ANOVA with the Dunnett test). The addition of Gremlin blocked the effect of BMP-4.

 
Gremlin Elevated IOP in the Perfused Anterior Eye Organ Model
Elevated Gremlin levels in the glaucomatous TM may be responsible for the ocular hypertension associated with glaucoma. To test this hypothesis, we studied the effect of Gremlin in an ex vivo model of perfusion-cultured human eye anterior segments. Ten micrograms Gremlin per milliliter was added to the perfusion medium based on the reported ED50 for Gremlin to inhibit BMP-4 activity in cultured cells (R&D Systems) and on dose–response studies in cultured TM cells. Continuous exposure to Gremlin for 4 days caused a significant increase in IOP compared to vehicle-treated contralateral eyes (n = 6, P < 0.05; Fig. 8A ). In a second study, perfusion with Gremlin also significantly elevated IOP compared with contralateral control eyes (P < 0.05, n = 5), and this IOP elevation was reversed by removal of Gremlin from the perfusion medium after 2 days (Fig. 8B) .


Figure 8
View larger version (29K):
[in this window]
[in a new window]

 
FIGURE 8. Effect of Gremlin on IOP in the perfused anterior segment organ culture model. Anterior segments from paired human donor eyes were placed in an ex vivo perfusion organ culture system. (A) One anterior segment from each pair was perfused with recombinant Gremlin (10 µg/mL perfusion medium) for 4 days. Gremlin caused a significant increase in IOP (n = 6; *P < 0.05). (B) One anterior segment from each pair was perfused with recombinant Gremlin (10 µg/mL perfusion medium) for 2 days followed by 2 days of perfusion with medium without Gremlin. Gremlin also significantly raised IOP when perfused for 2 days, and this effect was reversible on removal of Gremlin from the medium (n = 5; *P < 0.05 compared with vehicle-treated contralateral eyes).

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Glaucomatous elevated IOP is caused by increased AH outflow resistance4 and is closely associated with morphologic and biochemical changes that occur within the TM. For example, in patients with glaucoma, there is an accumulation of ECM proteins in the TM.4 5 Little is known about the cellular control of ECM synthesis, secretion, and degradation within the human TM. However, growth factors in AH or produced locally by TM cells may be of great importance, in that we have reported that human TM cells express numerous growth factor receptors and respond to exogenous growth factors.13 Thus, the accumulation of ECM proteins in the human TM may be directly controlled by growth factors.

Members of the TGF-ß superfamily of growth factors appear to be involved in the pathogenesis of glaucoma.6 TGF-ß2 levels are elevated in AH of patients with POAG,7 8 9 36 and exogenous TGF-ß2 increases ECM protein synthesis in cultured TM cells10 28 and in perfusion-cultured anterior eye organ cultures.11 In addition, increased cross-linking of TM ECM proteins by tissue transglutaminase and increased expression of PAI-1 are correlated with exogenous TGF-ß2 treatment.10 12 These reports indicate that TGF-ß2 is an important mediator of the synthesis, secretion, and degradation of ECM within the human TM. However, within a given tissue, the action of most growth factors is often counterbalanced by other growth factors so that normally, only small changes in tissue structure and function occur. Our data indicate that BMP-4 may counteract the effect of TGF-ß2 with respect to metabolism of ECM proteins within the human TM.

Several BMPs and their receptors are expressed and play a significant role in ocular development.37 38 Knockout studies have shown that BMP-4 and -7 are essential in the early morphogenesis of the eye.39 40 41 42 43 A recent report by Chang et al.44 showed that a heterozygous deficiency of BMP-4 results in anterior segment dysgenesis and elevated IOP, implicating the BMP pathway in glaucoma’s pathogenesis. The abnormalities were similar to those in patients with developmental glaucoma. Thus BMP-4 may be involved in developmental conditions associated with human glaucoma. Although BMPs, BMP receptors, and BMP antagonists have been reported to have significant roles in ocular development, their role in normal or diseased adult tissues is not well understood.

Our laboratory has shown that human TM cells express BMPs, BMP receptors, and mRNA for several BMP antagonists.20 In this study, we demonstrated that TM cells secrete BMP-4 and are capable of responding to exogenous BMP via the canonical Smad signaling pathway. We further demonstrated that BMP-4 inhibits the stimulation of FN secretion by TGF-ß2. It thus appears that BMP-4 may act normally to counteract the effects of TGF-ß2 on ECM proteins in the human TM.

Inhibition of TGF-ß signaling via BMP may not be a unique feature of the human TM. TGF-ß is known to be involved in the initiation and progression of renal disease, including renal fibrosis. Zeisberg et al.34 demonstrated that BMP-7 can reverse the epithelial-to-mesenchymal transition by directly counteracting TGF-ß-induced cell signaling. In a subsequent report,35 they indicated that direct counteraction between TGF-ß and BMP activation was unique, because it did not appear to involve either extracellular or intracellular BMP antagonists. Smad5-mediated BMP-7 signaling directly counteracted Smad3-dependent TGF-ß induced epithelial-mesenchymal transition in kidney tubules and mammary epithelial cells. In addition, Wang and Hirschberg45 demonstrated that BMP-7 inhibits TGF-ß driven fibrogenesis by mesangial cells. Inhibition of fibrogenesis occurred primarily by preventing TGF-ß-dependent downregulation of matrix degradation and upregulation of PAI-1. Finally, Izumi et al.46 reported that BMP-7 opposes TGF-ß1-mediated collagen induction in mouse pulmonary myofibroblasts. They demonstrated that BMP-7 suppresses TGF-ß action via the upregulation of Id2. Although BMP-4 caused phosphorylation of Smad proteins in the TM, we do not yet know whether the BMP-4 effect on TGF-ß2-induction of fibronectin in TM cells is mediated through the canonical BMP Smad signaling pathway. BMP also has been shown to signal via Smad-independent pathways, including MAP kinases.47 48

If BMP-4 acts to counterbalance the effect of TGF-ß2 and regulate normal TM function, then any alteration in BMP-4 expression or BMP signaling may contribute to the development of elevated IOP and glaucoma. We profiled gene expression of members of the BMP signaling gene family in normal and glaucomatous TM cells and found significantly increased expression of the BMP antagonist Gremlin in the glaucomatous TM cells. A statistically significant increase in both Gremlin mRNA and protein expression was shown by qPCR and Western immunoblot analyses. We also showed that Gremlin was present in vivo in TM tissue as well as in human AH and perfusate medium from perfusion-cultured human eyes. Gremlin is a secreted BMP antagonist that binds BMPs and prevents their interaction with the BMP receptor complex, thus reducing BMP biological activity.18 Gremlin was able to block the positive effects of BMP-4, which suppressed the TGF-ß2-induction of fibronectin in cultured TM cells. Even more important, the addition of recombinant Gremlin to the perfusate of ex vivo cultured human eyes caused the glaucomatous phenotype of elevated IOP, which was reversed on removal of Gremlin from the perfusate. We did not introduce exogenous BMP-4 or TGF-ß2 to the perfusion medium of the ex vivo perfusion organ-cultured eyes, yet Gremlin still was able to increase IOP. Because cultured TM cells and TM tissue make and secrete both TGF-ß213 and BMP-4,20 it is possible that Gremlin produces its IOP effect through interactions with endogenous TM tissue BMP-4/TGF-ß2 pathways. Alternatively, BMP-4 directly alters TM cell gene expression (Clark AF, unpublished data, 2005), so Gremlin may modulate normal BMP-4-mediated TM cell functions, independent of TGF-ß2’s effects.

A summary of the interaction of BMP, Gremlin, and TGF-ß2 within the human TM is shown in Figure 9 . We have demonstrated that TM cells normally express TGF-ß213 and BMP-4,20 and we now show that BMP-4 is capable of blocking TGF-ß2-stimulated ECM production in TM cells. Elevated IOP in glaucoma may be caused by increased TGF-ß2 levels in the AH and/or elevated Gremlin expression in the glaucomatous TM. Our results indicate that elevated Gremlin protein levels in POAG may act to antagonize the natural role of BMP-4 in the TM. In the presence of elevated Gremlin, BMP-4 is no longer capable of modifying the stimulatory role of TGF-ß2 on ECM protein accumulation, including fibronectin and collagens. Elevated TGF-ß2 levels in the AH of patients with POAG can stimulate increased TM ECM deposition and thereby elevate IOP. It is therefore possible that TM homeostasis is partially regulated by interacting complementary growth factor activities (e.g., BMP-4 and TGFß-2) resulting in normal accumulation of ECM proteins. A delicate balance exists in the TM between TGF-ß2 and BMP-4. Even though there may not be an obvious change in BMP-4 or BMP-R expression, elevated Gremlin would change the dynamics, and the balance would be shifted toward ECM deposition. It also is possible that some BMP-4 effects on the TM do not involve interactions with TGF-ß2 signaling and that increased Gremlin expression in glaucomatous TM cells alters TM cell functions independently, leading to increased outflow resistance and elevated IOP independent of TGF-ß.


Figure 9
View larger version (25K):
[in this window]
[in a new window]

 
FIGURE 9. Schematic representation of the interactions of BMP-4, TGF-ß2, and Gremlin within the TM. Elevated TGF-ß2 in the AH of patients with POAG may lead to increased deposition of ECM proteins in the TM. Increased ECM deposition would result in increased resistance to AH outflow and elevated IOP. BMP-4 normally acts to inhibit TGF-ß2 upregulation of ECM deposition and thus maintains a balance in synthesis, deposition, and degradation of ECM within the human TM. The overexpression of Gremlin, a secreted BMP antagonist, in glaucomatous TM, blocks the effect of BMP-4 and leads to an imbalance in TGF-ß2 action.

 


    Acknowledgements
 
The authors thank Paula Billman for acquisition of the donor eyes, Mitch McCartney and Karen Stropki for technical assistance on assessment of TM tissue viability in the perfusion culture experiments, and Robin Chambers and Debbie Lane for providing the cultured TM cells used in the study.


    Footnotes
 
2 Contributed equally to the work and therefore should be considered equivalent authors. Back

Supported by Alcon Research, Ltd.

Submitted for publication March 19, 2006; revised September 4, 2006; accepted January 10, 2007.

Disclosure: R.J. Wordinger, Alcon Research, Ltd. (F); D.L. Fleenor, Alcon Research, Ltd. (E); P.E. Hellberg, Alcon Research, Ltd. (E); Iok-Hou Pang, Alcon Research, Ltd. (E); T.O. Tovar, None; G.S. Zode, None; J.A. Fuller, None; A.F. Clark, Alcon Research, Ltd. (E)

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Abbot F. Clark, Glaucoma Research R2-41, Alcon Research, Ltd., 6201 South Freeway, Fort Worth, TX 76134; abe.clark{at}alconlabs.com.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Quigley HA. Number of people with glaucoma worldwide. Br J Ophthalmol. 1996;80:389–393.[Abstract/Free Full Text]
  2. Kass MA, Heuer DK, Higginbotham EJ, et al. The Ocular Hypertension Treatment Study: a randomized trial determines that topical ocular hypotensive medication delays or prevents the onset of primary open-angle glaucoma. Arch Ophthalmol. 2002;120:701–713.[Abstract/Free Full Text]
  3. Heijl A, Leske MC, Bengtsson B, Hyman L, Hussein M. Reduction of intraocular pressure and glaucoma progression: results from the Early Manifest Glaucoma Trial. Arch Ophthalmol. 2002;120:1268–1279.[Abstract/Free Full Text]
  4. Rohen JW. Why is intraocular pressure elevated in chronic simple glaucoma?. Ophthalmology. 1983;90:758–765.[ISI][Medline][Order article via Infotrieve]
  5. Lutjen-Drecoll E, Rittig M, Rauterberg J, Jander R, Mollenhauer J. Immunomicroscopical study of type VI collagen in the trabecular meshwork of normal and glaucomatous eyes. Exp Eye Res. 1989;48:139–147.[CrossRef][ISI][Medline][Order article via Infotrieve]
  6. Lütjen-Drecoll E. Morphological changes in glaucomatous eyes and the role of TGFß2 for the pathogenesis of the disease. Exp Eye Res. 2005;81:1–4.[CrossRef][ISI][Medline][Order article via Infotrieve]
  7. Tripathi RC, Li J, Chan WF, Tripathi BJ. Aqueous humor in glaucomatous eyes contains an increased level of TGF-beta 2. Exp Eye Res. 1994;59:723–727.[CrossRef][ISI][Medline][Order article via Infotrieve]
  8. Inatani M, Tanihara H, Katsuta H, Honjo M, Kido N, Honda Y. Transforming growth factor-beta 2 levels in aqueous humor of glaucomatous eyes. Graefes Arch Clin Exp Ophthalmol. 2001;239:109–113.[ISI][Medline][Order article via Infotrieve]
  9. Picht G, Welge-Luessen U, Grehn F, Lütjen-Drecoll E. Transforming growth factor beta 2 levels in the aqueous humor in different types of glaucoma and the relation to filtering bleb development. Graefes Arch Clin Exp Ophthalmol. 2001;239:199–207.[ISI][Medline][Order article via Infotrieve]
  10. Welge-Lussen U, May CA, Lütjen-Drecoll E. Induction of tissue transglutaminase in the trabecular meshwork by TGF-beta1 and TGF-beta2. Invest Ophthalmol Vis Sci. 2000;41:2229–2238.[Abstract/Free Full Text]
  11. Gottanka J, Chan D, Eichhorn M, Lütjen-Drecoll E, Ethier CR. Effects of TGF-beta2 in perfused human eyes. Invest Ophthalmol Vis Sci. 2004;45:153–158.[Abstract/Free Full Text]
  12. Fuchshofer R, Welge-Lussen U, Lütjen -Drecoll E. The effect of TGFb-2 on human trabecular meshwork extracellular proteolytic system. Exp Eye Res. 2003;77:757–765.[CrossRef][ISI][Medline][Order article via Infotrieve]
  13. Wordinger RJ, Clark AF, Agarwal R, et al. Cultured human trabecular meshwork cells express functional growth factor receptors. Invest Ophthalmol Vis Sci. 1998;39:1575–1589.[Abstract/Free Full Text]
  14. Wozney JM, Rosen V, Celeste AJ, et al. Novel regulators of bone formation: molecular clones and activities. Science. 1988;242:1528–1534.[Abstract/Free Full Text]
  15. Balemans W, Van Hul W. Extracellular regulation of BMP signaling in vertebrates: a cocktail of modulators. Dev Biol. 2002;250:231–250.[CrossRef][ISI][Medline][Order article via Infotrieve]
  16. Von Bubnoff A, Cho KW. Intracellular regulation in vertebrates: pathway or network?. Dev Biol. 2001;239:1–14.[CrossRef][ISI][Medline][Order article via Infotrieve]
  17. Hsu DR, Economides AN. The Xenopus dorsalizing factor gremlin identifies a novel family of secreted proteins that antagonize BMP activities. Mol Cell. 1998;1:673–683.[CrossRef][ISI][Medline][Order article via Infotrieve]
  18. Topol LZ, Bardot B. Biosynthesis, post-translational modification and functional characterization of Drm/gremlin. J Biol Chem. 2000;275:8785–8793.[Abstract/Free Full Text]
  19. Shimasaki S, Moore RK, Otsuka F, Erickson GF. The bone morphogenetic protein system in mammalian reproduction. Endocrince Revs. 2004;25:72–101.
  20. Wordinger RJ, Agarwal R, Talati M, Fuller J, Lambert W, Clark AF. Expression of bone morphogenetic proteins (BMP), BMP receptors, and BMP associated proteins in human trabecular meshwork and optic nerve head cells and tissues. Mol Vis. 2002;8:241–250.[ISI][Medline][Order article via Infotrieve]
  21. Wilson K, McCartney MD, Miggans ST, Clark AF. Dexamethasone induced ultrastructural changes in cultured human trabecular meshwork cells. Curr Eye Res. 1993;12:783–793.[ISI][Medline][Order article via Infotrieve]
  22. Steely HT, Browder SL, Julian MB, Miggans ST, Wilson KL, Clark AF. The effects of dexamethasone on fibronectin expression in cultured human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 1992;33:2242–2250.[Abstract/Free Full Text]
  23. Clark AF, Wilson K, McCartney MD, Miggans ST, Kunkle M, Howe W. Glucocorticoid-induced formation of cross-linked actin networks in cultured human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 1994;35:281–294.[Abstract/Free Full Text]
  24. Clark AF, Wilson K, de Kater AW, Allingham RR, McCartney MD. Dexamethasone-induced ocular hypertension in perfusion-cultured human eyes. Invest Ophthalmol Vis Sci. 1995;36:478–489.[Abstract/Free Full Text]
  25. Clark AF, Steely HT, Dickerson JE, Jr, et al. Glucocorticoid induction of the glaucoma gene MYOC in human and monkey trabecular meshwork cells and tissues. Invest Ophthalmol Vis Sci. 2001;42:1769–1780.[Abstract/Free Full Text]
  26. Wordinger RJ, Lambert W, Agarwal R, Talati M, Clark AF. Human trabecular meshwork cells secrete neurotrophins and express neurotrophin receptors (Trk). Invest Ophthalmol Vis Sci. 2000;41:3833–3841.[Abstract/Free Full Text]
  27. Pang I-H, Shade DL, Clark AF, Steely HT, DeSantis L. Preliminary characterization of a transformed cell strain derived from human trabecular meshwork. Curr Eye Res. 1994;13:51–63.[ISI][Medline][Order article via Infotrieve]
  28. Fleenor DL, Shepard AR, Hellberg PE, Jacobson N, Pang I-H, Clark AF. TFGb2-induced changes in human trabecular meshwork: implications for intraocular pressure. Invest Ophthalmol Vis Sci. 2005;47:226–234.[CrossRef]
  29. Johnson DH, Tschumper RC. Human trabecular meshwork organ culture: a new method. Invest Ophthalmol Vis Sci. 1987;28:945–953.[Abstract/Free Full Text]
  30. Clark AF, Brotchie D. Dexamethasone alters F-actin architecture and promotes cross-linked actin network formation in human trabecular meshwork tissue. Cell Motil Cytoskeleton. 2005;60:83–95.[CrossRef][ISI][Medline][Order article via Infotrieve]
  31. Pang IH, McCartney MD, Steely HT, Clark AF. Human ocular perfusion organ culture: a versatile ex vivo model for glaucoma research. J Glaucoma. 2000;9:468–479.[ISI][Medline][Order article via Infotrieve]
  32. Pang IH, Moll H, McLaughlin MA, et al. Ocular hypotensive and aqueous outflow-enhancing effects of AL-3037A (sodium ferri ethylenediaminetetraacetate). Exp Eye Res. 2001;73:815–825.[CrossRef][ISI][Medline][Order article via Infotrieve]
  33. Pang IH, Fleenor DL, Hellberg PE, Stropki K, McCartney MD, Clark AF. Aqueous outflow-enhancing effect of tert-butylhydroquinone: involvement of AP-1 activation and MMP-3 expression. Invest Ophthalmol Vis Sci. 2003;44:3502–3510.[Abstract/Free Full Text]
  34. Zeisberg M, Hanai J-I, Sugimoto H, et al. BMP-7 counteracts TGF-ß1-induced epithelial-to-mesenchymal transition and reverses chronic renal injury. Nat Med. 2003;9:964–968.[CrossRef][ISI][Medline][Order article via Infotrieve]
  35. Zeisberg M, Kalluri R. The role of epithelial-to-mesenchymal transition in renal fibrosis. J Mol Med. 2004;82:175–181.[CrossRef][ISI][Medline][Order article via Infotrieve]
  36. Ochiai Y, Ochiai H. Higher concentration of transforming growth factor-beta in aqueous humor of glaucomatous eyes and diabetic eyes. Jpn J Ophthalmol. 2002;46:249–253.[CrossRef][Medline][Order article via Infotrieve]
  37. Dudley AT, Robertson EJ. Overlapping expression domains of bone morphogenetic protein family members potentially account for limited tissue effects in BMP-7 deficient embryos. Dev Dyn. 1997;208:349–362.[CrossRef][ISI][Medline][Order article via Infotrieve]
  38. Liu J, Wilson S, Reh T. BMP receptor 1b is required for axon guidance and cell survival in the developing retina. Dev Biol. 2003;256:34–48.[CrossRef][ISI][Medline][Order article via Infotrieve]
  39. Furuta Y, Hogan BL. BMP-4 is essential for lens induction in the mouse embryo. Genes Dev. 1998.3764–3775.
  40. Luo G, Hofmann C, Bronkers AL, Sohocki M, Bradley A, Karsenty G. BMP-7 is an inducer of nephrogenesis and is also required for eye development and skeletal patterning. Genes Dev. 1995;9:2808–2820.[Abstract/Free Full Text]
  41. Dudley AT, Lyons KM, Robertson EJ. A requirement for bone morphogenetic protein-7 during development of the mammalian kidney and eye. Genes Dev. 1995;9:2795–2807.[Abstract/Free Full Text]
  42. Jena N, Martin-Seisdedos C, McCue P, Croce CM. BMP-7 null mutations in mice: developmental defects in skeleton, kidney and eye. Exp Cell Res. 1997;230:28–37.[CrossRef][ISI][Medline][Order article via Infotrieve]
  43. Wawersik S, Purcell P, Rauchman M, Dudley AT, Robertson EJ. BMP-7 acts in murine lens placode development. Dev Biol. 1999;207:176–188.[CrossRef][ISI][Medline][Order article via Infotrieve]
  44. Chang B, Smith RS, Peters M, et al. Haploinsufficient BMP-4 ocular phenotypes include anterior segment dysgenesis with elevated intraocular pressure. BMC Genetics. 2001;2:1–18.
  45. Wang S, Hirschberg R. Bone morphogenetic protein-7 signals opposing transforming growth factor beta in mesangial cells. J Biol Chem. 2004;279:23200–23206.[Abstract/Free Full Text]
  46. Izumi N, Mizuguchi S, Inagaki Y, et al. BMP-7 opposes TGFß-1-mediated collagen induction in mouse pulmonary myofibroblasts through Id2. Am J Physiol. 2006;290:L120–L126.
  47. Derynck R, Akhurst RJ, Balmain A. TGF-ß signaling in tumor suppression and cancer progression. Nat Genet. 2001;29:117–129.[CrossRef][ISI][Medline][Order article via Infotrieve]
  48. Isasaki M, Iguchi M. Specific activation of the p38 mitogen-activated protein kinase signaling pathway and induction of the neurite outgrowth in PC-12 cells by bone morphogenetic protein-2. J Biol Chem. 1999;274:26503–26510.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
IOVSHome page
T. Tovar-Vidales, R. Roque, A. F. Clark, and R. J. Wordinger
Tissue Transglutaminase Expression and Activity in Normal and Glaucomatous Human Trabecular Meshwork Cells and Tissues
Invest. Ophthalmol. Vis. Sci., February 1, 2008; 49(2): 622 - 628.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
G. S. Zode, A. F. Clark, and R. J. Wordinger
Activation of the BMP Canonical Signaling Pathway in Human Optic Nerve Head Tissue and Isolated Optic Nerve Head Astrocytes and Lamina Cribrosa Cells
Invest. Ophthalmol. Vis. Sci., November 1, 2007; 48(11): 5058 - 5067.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
R. J. Wordinger and A. F. Clark
Bone Morphogenetic Proteins and Their Receptors in the Eye
Experimental Biology and Medicine, September 1, 2007; 232(8): 979 - 992.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wordinger, R. J.
Right arrow Articles by Clark, A. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wordinger, R. J.
Right arrow Articles by Clark, A. F.