|
|
||||||||
1From the Section for Translational Research in Retinal and Macular Degeneration (STRRMD), National Institute on Deafness and Other Communication Disorders (NIDCD), and the 2STRRMD, National Eye Institute (NEI), National Institutes of Health, Bethesda, Maryland.
| Abstract |
|---|
|
|
|---|
METHODS. Subcellular fractions and fractions enriched in photoreceptor inner and outer segments were prepared from mouse retina by differential or density gradient ultracentrifugation. Immunoblot analysis was used to assess the expression of RS in various subcellular compartments and its fractionation into soluble phase on treatment of retinal cell membranes with several solubilizing reagents. RSlipid interactions were evaluated by a proteinlipid overlay assay that used wild-type and mutant forms of RS discoidin domain glutathione S-transferase (GST) fusion proteins. The subcellular localization of RS in mouse retina was visualized by pre-embedding immunogold electron microscopy. Ultrastructure was evaluated by transmission electron microscopy.
RESULTS. RS was intimately associated with cell membranes of the retina. It was found to cluster on the outer leaflet of the plasma membrane of the photoreceptor inner segments, which synthesize and secrete it. It was released from the membrane at high pH, which is characteristic of a peripheral membrane protein. It was extracted from the membrane by the nonionic detergent NP-40, together with glycerophospholipids. Proteinlipid overlay assays indicated a preferential interaction between RS and anioic phospholipids. Extraction of RS from the membrane was inhibited by divalent cations. Photoreceptor inner segment morphology was markedly affected in RS/y mice, which failed to express RS protein.
CONCLUSIONS. RS in intact retina is a peripheral membrane protein. Although distributed over the two membrane faces, RS is associated primarily with the outer leaflet of the inner segment plasma membrane through anionic phospholipids and divalent cations. RSs localization in photoreceptors and its biochemical properties suggest a functional role locally, at the site of secretion and membrane adhesion, in maintaining the photoreceptor inner segment stability and architecture.
RS is synthesized by retinal photoreceptors and other retinal neurons, and after the cleavage of the N-terminal signal sequence (amino acids 123), it is secreted into the extracellular space.7 8 9 A recent study identified two mature forms of RS in murine retina that differed by two amino acids at the N terminus.10 Processing of RS signal sequence at two cleavage sites (between amino acids 21-22 and 23-24) by signal peptidase was suggested as the basic mechanism underlying their occurrence in vivo. RS exists as a disulfide-linked homo-octamer.11 Because it is distributed throughout the retina, it has been proposed that RS is secreted from photoreceptor inner segments and is transported by Müller cells into the inner retina.9 12 However, our previous studies demonstrated that all major classes of adult retinal neurons have RS message and express the protein, suggesting that RS is synthesized locally by neurons, even in the inner retina.13
A conserved discoidin domain (DD) sequence of 155 to 160 amino acids comprises most of the RS molecule.1 Members of the DD family of proteins are involved in cell adhesion and cellcell interactions.14 Although previous studies have shown that RS is associated with the membrane fraction of retinal homogenates,7 neither the biochemical nature of RS association with the membrane nor its organization in the retina at the ultrastructural level has been reported. In this study, we used biochemical and molecular biology methods to describe the nature of RSmembrane associations and to understand the molecular mechanism by which RS maintains the structural and functional integrity of the retina. RS was localized on photoreceptors by immunoelectron microscopy, and the ultrastructural features of photoreceptors in Rs1 knockout (RS1/y) mice were visualized with electron microscopy. Results demonstrate that RS is a peripheral membrane protein that is bound to anionic phospholipids on the outer leaflet of the plasma membrane. Divalent cations influence RS association with the membrane. The biochemical properties of RS and its localization on the inner segment plasma membrane suggest that it has a functional role locally at the site of secretion and that association with the membrane is necessary for maintaining the stability and architecture of the photoreceptor inner segment.
| Materials and Methods |
|---|
|
|
|---|
Antibodies and Reagents
The rabbit polyclonal RS antibody was raised against a synthetic peptide corresponding to the amino acid residues 24-37 of RS.13 The following antibodies were also used: human factor VIII; lactase dehydrogenase (LDH); the
subunit of Na+,K+-ATPase; rhodopsin; collagen types I, IV and XVII (Santa Cruz Biotechnology, Santa Cruz, CA); monoclonal anti-collagen type II and III (Sigma-Aldrich, St. Louis, MO); anti-Cyt Oxi IV (MitoSciences, Eugene, OR); non-NMDA receptor subunit I (gift from Robert Wenthold, NIDCD/NIH); flottilin 1 (BD Biosciences, Franklin Lakes, NJ), and anti-glutathione S-transferase (GST) (GE Healthcare/Life Sciences, Piscataway, NJ). Reagents were collagens, human lung type I, bovine type II and III (Southern Biotech, Birmingham, AL); mouse collagen IV (Cultrex; Trevigen, Gaithersburg, MD); Igepal CA630/NP40, glutathione, isopropyl-ß-D-thiogalactoside, imidazole, phospholipase C from Bacillus cereus (Sigma-Aldrich); PIP Strips (Echelon Biosciences, Salt Lake City, UT); glutathione-Sepharose, chemiluminescent Western blot detection reagent, and secondary horseradish peroxidaselinked anti-mouse or anti-rabbit IgG (GE Healthcare/Life Sciences); phospholipids (Avanti Polar Lipids Inc., Alabaster, AL); Factor VIII (Bayer Health Care, Leverkusen, Germany); and protease inhibitor cocktail tablets (Roche Diagnostics, Indianapolis, IN). Analytical grade reagents were obtained from Sigma-Aldrich, Bio-Rad Laboratories (Hercules, CA), or Electron Microscopy Sciences (Hatfield, PA).
Subcellular Fractionation
Protease inhibitor cocktail was included in all the isolation and incubation media. Retinas from 8- to 10-week-old C57BL/6J mice (Jackson Laboratories, Bar Harbor, ME) were homogenized in three volumes of ice-cold HME buffer (20 mM HEPES [pH 7.4], 1 mM MgCl2, 0.1 mM EGTA, 1 mM dithiothreitol [DTT], and protease inhibitor cocktail). The homogenates were differentially centrifuged to isolate membrane and cytosolic fractions. The photoreceptor rod outer segments and a fraction enriched in rod inner segments were isolated after a discontinuous sucrose density gradient centrifugation.15 The rod outer segment (32%37% sucrose interphase) and inner segment (37%42% sucrose interphase) enriched fractions were collected and resuspended in 100 mM NaCl, 1 mM EDTA, 10 mM Tris-HCl (pH 7.4), and protease inhibitor cocktail. The purity of isolated fractions was assessed by immunoblot analysis of the following marker proteins: rhodopsin (rod outer segments), cytochrome c oxidase subunit IV (Cyt Oxi IV-mitochondria/photoreceptor inner segment), LDH (cytosol), and the
subunit of Na+,K+-ATPase (plasma membrane). Protein concentrations of samples were determined by a colorimetric method with the bicinchoninic acid (BCA) kit (Pierce Biotechnology, Inc., Rockford, IL).
Membrane Extraction
Alkaline and high salt extraction of membrane fractions was performed essentially as described earlier.16 The membrane fractions (100 µg protein) were adjusted to 50 mM Na2CO3, 1 M KI, 0.3 M KCl, and 1 M KCl by the addition of respective stock solutions of 1 M Na2CO3, 2 M KI (freshly made in 50 mM Tris-HCl [pH 7.5]), and 3 M KCl and incubated on ice for 15 minutes with occasional vortexing. To pellet the insoluble fraction, the mixture was layered over 0.6 M sucrose and centrifuged at 100,000g for 30 minutes (TLA 100.2; Beckman, Fullerton, CA) The pellets were solubilized in SDS sample buffer, and the supernatants were precipitated in trichloroacetic acid and solubilized in SDS sample buffer. The pellets and the supernatant fractions were adjusted to equal volumes and analyzed for RS by SDS-PAGE followed by immunoblot analysis.
Protease Protection Assays
For protease protection assays, freshly prepared microsomal membrane fractions (80100 µg protein in 320 mM sucrose and 10 mM HEPES [pH 7.4]) were adjusted to 10 mM CaCl2 and incubated at 0°C for 40 minutes with various amounts of trypsin and chymotrypsin (1, 3, 5, and 10 µg each), with or without 1% Triton X-100 present.17 After 30 minutes, 40 µg of aprotinin was added to each sample, and incubation was continued for 5 minutes on ice. After ultracentrifugation (100,000g for 30 minutes) the protease-resistant membrane fractions recovered in pellets were analyzed for RS by SDS-PAGE and immunoblot analysis. The integrity of the membranes and the validity of the assay was confirmed by reprobing the blots with the following antibodies directed against the membrane-oriented protein epitopes: H-300, a polyclonal antibody raised against amino acids 551-850 mapping within the transmembrane and cytosolic region of Na+,K+-ATPase
(Santa Cruz Biotechnology, Inc.), and APC-035, a polyclonal antibody raised against the C terminus amino acids 356-375 of Kir4.1 (Alomone Laboratories, Ltd., Jerusalem, Israel).
Extraction of Membranes with NP-40 and Triton X-114 Phase Separation
Aliquots (100-µg) of the membrane proteins in 200 µL buffer (320 mM sucrose, 10 mM HEPES [pH 7.4] plus protease inhibitor cocktail) containing different concentrations of NP-40 were incubated for 10 minutes at 25°C.18 After high-speed centrifugation at 30,000g for 20 minutes, the detergent-insoluble and soluble phases were separated and adjusted to equal volumes, and the amount of RS in each fraction was determined by immunoblot analysis. The Triton X-114 phase separation was performed essentially as described by Bordier.19 The membrane pellets prepared from the sucrose density gradient sedimentation were diluted to 2 mg protein/mL in 10 mM-HEPES-NaOH (pH 7.4) and precondensed Triton X-114 was added to a final concentration of 2% in a total volume of 0.2 mL. Detergent-insoluble material was removed by centrifugation at 16,000g for 15 minutes at 4°C, and soluble fractions were subjected to aqueous and detergent phase separation at cloudy point temperature above 20°C. Integral proteins partition into the detergent phase, whereas most peripheral proteins go into the aqueous phase. The two phases were subjected to one round of washing, and the volumes were adjusted to the original volume of the extract. Equal volumes were used for SDS/PAGE and immunoblot analysis.
The effects of divalent cations on RS extraction were probed by using freshly isolated retinal cell membranes (100 µg protein in 160 mM Tris-HCl [pH 7.4] or PBS [pH 7.4]) incubated for 60 minutes at 37°C in the absence or presence of divalent cations or chelating agents. After centrifugation at 100,000g for 15 minutes, the soluble fractions were analyzed for RS by SDS-PAGE and immunoblot analysis. To assess the effect of divalent cations on NP-40 extraction of RS, the membranes were first preincubated for 10 minutes on ice in various buffers in the presence or absence of Ca2+ or Mg2+. After the addition of NP-40 (final concentration 0.2%), the samples were further incubated for 10 minutes at 25°C. The incubation medium was centrifuged, and the RS released into the supernatant was analyzed by immunoblot analysis. The experimental conditions for PLC treatment and divalent cation effects are described in the corresponding figure legends.
Thin Layer Chromatography
The pellet and supernatant fractions obtained after extraction of the retinal membranes with 0.1% NP-40 were extracted in a 1:1 mixture of chloroform and methanol for 10 minutes on ice. After the addition of 0.25 mL of water, the emulsion was centrifuged for 5 minutes. The lower organic phase was recovered and dried under nitrogen. The samples were dissolved in chloroform, and equal volumes were subjected to lipid analysis by thin-layer chromatography (TLC) on precoated silica gel H plates (Analtech Inc., Newark, DE) using the chloroform-methanol-acetic acid-water solvent system (volumes, 50:37.5:3.5:2).20 Lipids were visualized by exposing the plate in an iodine chamber. Standard lipids for each class were spotted on the same plate for comparison and identification of lipids in the samples.
Immunoprecipitation, SDS-PAGE, and Western Blot
Whole-cell lysates were prepared from mouse retina by the freezethaw method in a lysis buffer (10 mM Tris-HCl [pH 7.4] 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 1 mM EGTA, and 0.5% Igepal CA 630, plus protease inhibitor cocktail). Whole-cell extracts or membrane fractions representing an equal amount of protein were resolved by 10% SDS-PAGE under reducing conditions and transferred to polyvinylidene difluoride (PVDF) membranes (BioRad Laboratories). Blots were incubated with appropriate primary and secondary antibodies followed by chemiluminescent detection (Super Signal West Dura; Pierce Biotechnology). The blots were scanned and signals quantified (Image Station 2000R; Eastman Kodak, Rochester, NY) For reprobing the blots were stripped in Western blot stripping buffer (Restore; Pierce Biotechnology). Immunoprecipitation was performed overnight in 0.5 mL lysis buffer containing 500 µg total cell extract and 2 to 4 µg of the respective antibodies. The immunocomplexes were captured by protein A agarose beads, and profiles of the proteins pulled down by the antibodies were analyzed by Western blot analysis.
GST-RS Discoidin Domain Fusion Constructs, Site-Directed Mutagenesis, and GST Fusion Proteins
The primer pair with the EcoRI or XhoI restriction sites 5'-ggaattc TGCCCATATCACAAGCCCCTG and 5'-gctcgag TCAACACTCAAGCAGCTCCATCCG was used to amplify the discoidin domain region (amino acids 63-219) of mouse RS. The amplified fragment was cloned into the EcoRI-XhoI sites of a cloning vector (pCR-Blunt II-TOPO; Invitrogen, Carlsbad, CA). For production of recombinant mouse RS discoidin domain fused to GST, the discoidin domain insert from TOPO vector was subcloned into EcoRI-XhoI sites of vector (pGEX 6P1; GE Healthcare/Life Sciences). Correct fusion of this construct and the mutant constructs were confirmed by automated DNA sequencing. Wild-type mouse RS discoidin domain (RS-WT) was expressed in Escherichia coli strain BL21 after transformation of the expression plasmid, using standard methods recommended by the manufacturer (GE Healthcare/Life Sciences). Replacement of Tyr-89 (Y-89), Trp-92 (W92), and Phe-108 (F108) residues with Cys (C) was performed by using a site-directed mutagenesis kit (QuikChange; Stratagene, La Jolla, CA) and appropriate primers. The pGEX-6P constructs encoding the WT and mutant versions of the RS discoidin domain were transformed into BL21 E. coli cells (Invitrogen). The growth of E. coli cells, induction by isopropyl-ß-D-thiogalactoside, and harvesting and purification of GST recombinant proteins on glutathione-Sepharose columns were performed according to the manufacturers protocol (GE Healthcare/Life Sciences).
Lipid-Protein Overlay Assay
To assess the lipid-binding properties of RS, we performed a proteinlipid overlay assay with recombinant GST fusion proteins encoding wild-type RS discoidin domain sequence or its mutant versions (RS-WT). A nitrocellulose membrane with immobilized phospholipids (PIP Strips; Echelon Biosciences) was blocked for 1 hour in 3% (wt/vol) fatty acid-free BSA in TBST (50 mM Tris-HCl [pH 7.5] and 150 mM NaCl, and 0.1% [vol/vol]) Tween 20). It was then incubated overnight at 4°C with gentle stirring in the same solution containing either 200 ng/mL of purified wild-type RS or mutant versions of RS discoidin domain encoding GST fusion proteins. The membranes were later incubated for 1 hour with a 1:2000 dilution of anti-GST antibody followed by a 1-hour incubation with 1:5000 dilution of anti-rabbit-HRP conjugate. The washing steps were repeated between all incubation steps and before detection by chemiluminescence. The binding of positive controls (GRIP and factor VIII) to lipids was detected by using anti-GST or anti-factor VIII monoclonal antibodies followed by a 1-hour incubation with 1:5000 dilution of anti-mouse-HRP conjugate.
Fractionation of Lipid-Rich and Other Plasma Membrane Domains
Retinas were homogenized in ice-cold isolation medium (150 mM NaCl, 1 mM DTT, and 25 mM Tris-HCl [pH 7.4]) in the presence of either 5 mM EDTA (minus Ca2+) or 5 mM Ca2+ and centrifuged at 1000g for 10 minutes. The supernatant was adjusted to 1% Triton X-100 and left on ice for 30 minutes. The lysate was later adjusted to 40% iodixanol (OptiPrep; Axis-Shield, Norton, MA) and 0.8 mL of it was placed at the bottom of the 4-mL tubes of a swinging-bucket rotor (SW 60 Ti; Beckman Coulter) and overlaid with 0.8 mL of 35%, 30%, 25%, and 20% iodixanol in the isolation medium. The tubes were spun at 160,000g for 5 hours at 4°C. Sixteen gradient fractions of 250 µL each were collected from the top to the bottom of the tube and analyzed for RS and flottilin by Western blot.
Electron Microscopy
Mice were deeply anesthetized with ketamine (50 mg/kg) and xylazine (5mg/kg) and perfused transcardially with 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer (pH 7.4). Eyes were enucleated and hemisected, and the posterior eye cup segments were immersed in fixative for 2 hour and rinsed in phosphate-buffered saline (PBS) at 4°C overnight. For transmission electron microscopy, the fixed eye cups were dehydrated in ethanol in series (30%, 50%, 70%, and 96%), block-stained in 1% uranyl acetate in absolute ethanol for 1 hour, rinsed in 2x absolute ethanol and embedded via propylene oxide in epoxy resin (Embed 812; Electron Microscopy Science). Ultrathin sections were cut and poststained in uranyl acetate and lead citrate. For immunoelectron microscopy, wild-type eye cups were embedded in 5% agarose/PBS and sectioned at 50-µm thickness on a microtome (Vibratome, St. Louis, MO) and then processed for pre-embedding immunoelectron microscopy. Microtome-cut sections were preincubated in 10% normal goat serum (NGS) diluted in PBS for 2 hours and then incubated for 48 hours at 4°C in an anti-RS antibody diluted in PBS-1% NGS. After this the sections were incubated in a mixture of goat anti-rabbit affinity-purified Fab fragment coupled to 1.4-nm gold (1:100; Nanoprobes Inc., Stony Brook, NY). Gold particles were enhanced by silver amplification for 8 to 12 minutes (HQ Silver ki; Nanoprobes). Sections were treated with 1% OsO4 and contrasted in 1% uranyl acetate before embedding (Embed 812; Electron Microscopy Sciences). Serial electron microscopic sections were cut and collected on polyvinyl formal-coated copper slot grids and observed by electron microscope (JEOL, Tokyo, Japan).
All experiments were performed in triplicate, and representative results are presented.
| Results |
|---|
|
|
|---|
|
|
Membrane Orientation of RS
As a means to verify the membrane orientation of RS, the membrane fractions were subjected to protease (trypsin/chymotrypsin) digestion in the presence or absence of Triton X-100, and the protease resistant membrane fractions recovered in pellets were analyzed for RS by immunoblot analysis (Fig. 3) . Protease treatment selectively digests proteins that face the extracellular space. Protein epitopes that reside within the transmembrane domain or on the cytoplasmic side of the plasma membrane are protected from digestion in the absence of detergent. However, treatment of the membrane fractions with detergent before protease digestion disrupts the membrane integrity and allows access of the protein epitopes to the protease.
|
1, and APC-035, raised against C terminus amino acids 356-375 of Kir4.1, detected their respective proteins in membranes that were digested with the protease in the absence of detergent (Fig. 3) . This result indicates that the transmembrane domain, protected by the lipid bilayer, and the intracellular C terminus domain were inaccessible to externally added protease and thus remained insensitive to protease digestion in the absence of the detergent. However, both Na+,K+-ATPase
1 and Kir4.1 disappeared on immunoblots when membrane integrity was first compromised by Triton X-100, so as to allow access of the protease to the protein epitopes. These results thus confirm that most of the membrane vesicles used in this study were in the right-side-out (extracellular space-side-out) orientation.
The majority of RS (
75%80%) was sensitive to protease in the absence of detergent and was digested at the lowest concentration of the protease (1 µg, Fig. 3 ). This result indicates that this pool of RS is located on the external surface of the plasma membrane and therefore is readily accessible to protease. Of interest, 20% to 25% of RS remained resistant to protease in the absence of detergent, even at higher concentrations of the protease. This pool of RS is not inherently protease resistant, because it was digested when membrane integrity was disrupted with detergent before protease treatment. Since RS lacks a transmembrane domain, this result is consistent with the possibility that the protease-resistant RS is associated with the cytoplasmic side of the plasma membrane. All these data taken together suggest that a major pool of RS is on the outer surface of the plasma membrane, whereas 20% to 25% of RS remains bound to the intracellular surface.
RS Interaction with Membrane Phospholipids
Membrane extractions were performed in the presence of various concentrations of the nonionic detergent NP-40. With centrifugation, RS partitioned totally into the soluble (supernatant) phase at detergent concentrations as low as 0.1% (Fig. 4A) . Glycerophospholipids were also preferentially solubilized at these low concentrations of the detergent. Qualitative analysis of the lipids in the supernatant fractions by thin layer chromatography revealed almost total partitioning of the glycerophospholipids (phosphatidylcholine[PC]; phosphatidylserine [PS]; phosphatidylinositol [PI]; phosphatidylethanolamine [PE]) into the soluble phase (Fig. 4B) . This implies that RS is extracted together with the glycerophospholipids after NP-40 treatment. Cholesterol was not resolved in this solvent system. However, it is known that at such low concentrations of detergent most of the cholesterol and sphingomyelin remain in the membrane.18 Thus, RS is not likely to be associated with membrane cholesterol or sphingomyelin, as discussed in the following sections.
|
RS Binding to Negatively Charged Phospholipids in ProteinLipid Overlay Assays
To assess the lipid-binding properties of RS directly, we assayed full-length RS discoidin domain (RS-WT) fusion proteins for binding to phospholipids in a lipid blot (Fig. 5) . The controls gave results consistent with their known binding specificities, and GST alone did not bind lipids (Fig. 5B) . The positive control, GST-GRIP (Multi PIP Grip; Echelon Biosciences) bound primarily PtdIns(3,4) P2 and PtdIns(3,4,5) P3. Factor VIII bound phosphatidylserine (PS) preferentially compared with other negatively charged phospholipids, which is consistent with the selectivity of the C2 discoidin domain for PS.21 The recombinant RS wild-type discoidin domain (RS-WT) displayed moderate- to high-affinity binding to negatively charged phospholipids and bound robustly to PtdIns (3)P, PtdIns(3,4)P2, PtdIns(3,5)P2, PtdIns(4,5)P2, and PS (Fig. 5C) . RS-WT also displayed moderate binding to PtdIns(4)P, PtdIns(5)P, and PtdIns(3,4,5)P3. RS-WT did not bind to phosphatidylethanolamine (PE), phosphatidylcholine (PC), and other lysophospholipids (Fig. 5C) . These results reflect the general affinity of RS for negatively charged membrane phospholipids. Such RS-lipid interactions have also been suggested by a 3D structure model of RS that has been generated by sequence alignment of RS with the discoidin domain sequences and the crystal structures of factors V and VIII.22
|
Influence of Ionic Milieu on RSMembrane Association
The influence of ionic environment on the association of RS with anionic phospholipids was analyzed by examining the effect of divalent cations (Ca2+/Mg2+) and chelating agents (EDTA/EGTA) on the release of RS from freshly isolated retinal cell membranes into the incubation medium. RS in the medium was analyzed by Western blot (Fig. 6) . Incubation of membranes in Tris-HCl (pH 7.4; physiological strength: 160 mM) buffer alone yielded increased release of RS from membranes compared to PBS (Fig. 6A) . Inclusion of either Ca2+ or Mg2+ (5 mM) in the buffer prevented the release of RS from the membranes, whereas similar concentrations of EGTA or EDTA resulted in the highest release of RS (Fig. 6A) . The presence of protease inhibitors in the incubation media excluded the contribution of proteases to the release of RS. Most important, extraction of RS by NP-40 was prevented by elevating the Ca2+ (5 mM) concentration in the medium (Fig. 6B) . In this case, equimolar concentrations of EGTA did not reverse the effect. Probably a higher concentration of chelating agent is needed.
|
Ca2+ Dependent Changes in Membrane
We investigated whether the inability of detergent to release RS from the membrane in the presence of Ca2+ might result from a Ca2+ induced membrane restructuring and redistribution of RS in the membrane. Membrane changes were assessed by analyzing the distribution of lipid rafts. Mouse retinas were solubilized in Triton X-100 both in the absence and presence of 5 mM Ca2+, and lipid rafts were prepared by discontinuous iodixanol density gradient fractionation. In the absence of Ca2+, the raft membrane marker flottilin-1 was found primarily in lighter iodixanol gradient density fractions 1 to 4 (Fig. 7A) . Proteins associated with cholesterol and sphingomyelin are known to sediment in these lighter density fractions.23 Preparation of membrane rafts in the presence of Ca2+ gave recovery of flottilin-1 across a broader density range of bands 1 to 8, indicating a structural rearrangement in the membrane and redistribution of flottilin-1 (Fig. 7A) . However, RS was distributed only in the high-density fractions 14 to 16 (Fig. 7B) , consistent with lack of association of RS with cholesterol or sphingomyelin. In contrast to flottilin 1, the presence of Ca2+ did not shift the RS gradient pattern, as RS was once again recovered in fractions 14 to 16 of the membrane raft preparation. The slight increase in the intensity of fraction 14 (Fig. 7B) in the presence of Ca2+ was deemed not significant. Hence, although a Ca2+-dependent membrane restructuring caused a redistribution of flottilin-1, this was not accompanied by any apparent Ca2+-dependent change in RS distribution in the membrane.
|
|
|
| Discussion |
|---|
|
|
|---|
A correlation between the detergent extraction properties of RS and glycerophospholipids provided the initial evidence that RS is anchored to the membrane through an association with glycerophospholipids. Further work demonstrated a general affinity of RS for the negatively charged glycerophospholipids on the membrane surface. Our data suggest that the interactions with negatively charged glycerophospholipids are critical for RS binding to membranes and that RS exhibits a preference for binding to certain lipid moieties, such as phosphatidylserine. The affinity of RS for membrane surface was also influenced by divalent cations. The lipid-binding properties of RS as well as its sensitivity to divalent cations are consistent with charge interactions that are important structural and functional features of proteins. Divalent cations mediate an interaction between a protein and its ligand and also influence the binding of proteins to phospholipids. Many examples of proteins with Ca2+-dependent phospholipid binding characteristics exist. Annexin II is present in both extracellular and intracellular compartments and binds phospholipids in a Ca2+ dependent manner to bring about a new configuration of the membrane-bound components.24 Ca2+-dependent phospholipid binding to the C2A and C2B domains of synaptotagmin 1 triggers neurotransmitter release.25 Ca2+ has also been shown to induce restructuring and sugar-binding affinity of discoidin 1, an adhesive protein from Dictyostelium discoideum.26 Although our in vitro data revealed that Ca2+ caused membrane remodeling, it did not alter the distribution of RS on the membrane.
What little we know about the molecular interactions of RS has been extrapolated from knowledge about the conserved 157 amino acid discoidin domain sequence that comprises approximately 75% of the mature RS protein. Several families of extracellular and transmembrane proteins involved in cell adhesion, cellcell interaction, and cell signaling, including the blood coagulation factors V and VIII and the discoidin domain receptors 1 and 2 (DDR1 and DDR2), display this conserved sequence in single or multiple copies.14 RS shares 37.2% sequence homology with factors V and VIII. In fact, the molecular basis of the protein defects underlying the XLRS pathology has been predicted from the sequence alignment of RS with the discoidin domain sequences of factors V and VIII and from a 3D model of RS that was generated from factors V and VIII crystal structure data.27 Phospholipids and collagens serve as ligands for discoidin domains present in blood coagulation factors and discoidin domain receptors, respectively.14 Our finding that RS associates with phospholipids is in agreement with the 3D model calculated for RS, which predicted a possible role of phospholipids in RS interactions.22 Consistent with this model, mutagenesis of the two conserved aromatic amino acids Tyr-89 and Trp-92, which had been predicted to act as membrane interaction spikes, affected the binding of RS to phosphatidylserine. Together, these results suggest that negatively charged anionic lipids are critical for RS binding to plasma membrane and RS exhibits a preferential affinity for phosphatidylserine.
Two types of functional interactions between RS and membranes can be envisioned. RS bound to the cell surface via lipid or ionic interactions may provide the molecular architecture necessary to stabilize membranes. Alternatively, RS may mediate the association of the extracellular matrix with the surface of photoreceptor and other retinal cells to promote cell adhesion and thereby stabilize the cellular architecture of the highly structured retinal tissue. In the homo-octameric form,11 RS that is bound to cell membrane through phospholipids would have sites open to interact with other extracellular proteins such as collagens and with carbohydrates. Although there is no current evidence of type I collagen in the retina, we found that full-length recombinant RS could bind to type I collagen in vitro (results not shown). However, our immunoprecipitation experiments (results not shown) gave no evidence that RS interacts with collagen types II, III, and XVII, which are present in the retina.28 29 It may be difficult to identify RS complexes by coimmunoprecipitation from detergent cell lysates, because these complexes represent only a minor fraction of total cellular proteins and therefore are difficult to target with antibodies. Although a recent study demonstrated the association of RS with extracellular ß2 laminin and intracellular
B crystallin, no direct interaction between RS and the putative interacting protein was established.30
Immunoelectron microscopy revealed extensive accumulation of RS on membrane surfaces and indicated binding of RS to the outer leaflet of the photoreceptor inner segment plasma membrane. In addition, loss of RS expression in RS1/y mice altered the normal morphology of the inner segment membranes. This suggests that RS may act locally to maintain the photoreceptor inner segment stability and architecture, and that it is not secreted only for export to the inner retina as previously proposed.12 Most important, the high affinity of RS for membrane surfaces would restrict its diffusion into the extracellular matrix and may be the reason that, despite the close proximity of the photoreceptor outer and inner segments, we found no evidence by electron microscopy that RS is present on connecting cilium and outer segment membranes. In summary, we propose that disruption of the inner segment architecture due to the loss of RS on inner segments may be the basic mechanism that underlies the displacement and disorganization of photoreceptors that we have seen in the RS1/y mice retinas.6 RS bound by phospholipids on the membrane surface can participate in cellmatrix and cellcell interactions, which will influence cytoskeletal organization. Other adhesion molecules have been shown to integrate signaling events between the extracellular matrix and the intracellular cytoskeleton.31 32 Future studies are needed to address the molecular mechanisms and the role of RS in such events.
| Acknowledgements |
|---|
| Footnotes |
|---|
Submitted for publication August 3, 2006; revised September 21 and November 1, 2006; accepted January 11, 2007.
Disclosure: C. Vijayasarathy, None; Y. Takada, None; Y. Zeng, None; R.A. Bush, None; P.A. Sieving, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: Paul A. Sieving, National Eye Institute, National Institutes of Health, 31 Center Drive, Building 31, Room 6A03, MSC 2510, Bethesda, MD 20892; camasamv{at}nidcd.nih.gov.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Haruta, R. A. Bush, S. Kjellstrom, C. Vijayasarathy, Y. Zeng, Y.-Z. Le, and P. A. Sieving Depleting Rac1 in mouse rod photoreceptors protects them from photo-oxidative stress without affecting their structure or function PNAS, June 9, 2009; 106(23): 9397 - 9402. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takada, C. Vijayasarathy, Y. Zeng, S. Kjellstrom, R. A. Bush, and P. A. Sieving Synaptic Pathology in Retinoschisis Knockout (Rs1-/y) Mouse Retina and Modification by rAAV-Rs1 Gene Delivery Invest. Ophthalmol. Vis. Sci., August 1, 2008; 49(8): 3677 - 3686. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gerth, R. J. Zawadzki, J. S. Werner, and E. Heon Retinal Morphological Changes of Patients With X-linked Retinoschisis Evaluated by Fourier-Domain Optical Coherence Tomography Arch Ophthalmol, June 1, 2008; 126(6): 807 - 811. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Ko, Y. Liu, L. Shi, D. Trump, and G. Y.-P. Ko Circadian Regulation of Retinoschisin in the Chick Retina Invest. Ophthalmol. Vis. Sci., April 1, 2008; 49(4): 1615 - 1621. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Johnson, N. Aoyama, N. H. Friedell, S. Ikeda, and A. Ikeda Genetic Modification of the Schisis Phenotype in a Mouse Model of X-Linked Retinoschisis Genetics, March 1, 2008; 178(3): 1785 - 1794. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Molday, W. W. H. Wu, and R. S. Molday Retinoschisin (RS1), the Protein Encoded by the X-linked Retinoschisis Gene, Is Anchored to the Surface of Retinal Photoreceptor and Bipolar Cells through Its Interactions with a Na/K ATPase-SARM1 Complex J. Biol. Chem., November 9, 2007; 282(45): 32792 - 32801. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kjellstrom, R. A. Bush, Y. Zeng, Y. Takada, and P. A. Sieving Retinoschisin Gene Therapy and Natural History in the Rs1h-KO Mouse: Long-term Rescue from Retinal Degeneration Invest. Ophthalmol. Vis. Sci., August 1, 2007; 48(8): 3837 - 3845. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |