(Investigative Ophthalmology and Visual Science. 2007;48:2095-2098.)
© 2007 by The Association for Research in Vision and Ophthalmology, Inc.
DOI: 10.1167/iovs.06-0516
Prostaglandin FP Receptors Do Not Contribute to 24-hour Intraocular Pressure Variation in Mice
Jonathan G. Crowston,1
Christy A. Morris,2
James D. Lindsey,2 and
Robert N. Weinreb2
1From the Center for Eye Research Australia, Melbourne University, Melbourne, Australia; and the
2Hamilton Glaucoma Center and Department of Ophthalmology, University of California San Diego, La Jolla, California.
 |
Abstract
|
|---|
PURPOSE. It is not known whether the prostaglandin FP receptor plays an important role in endogenous 24-hour regulation of intraocular pressure. The purpose of this study was to compare 24-hour intraocular pressure (IOP) in FP receptorknockout mice with that of wild-type mice that have normal FP receptor expression.
METHODS. The 24-hour IOP profile was determined by rebound tonometry in FP-knockout and wild-type mice. Peak and trough IOP was then measured by microneedle cannulation of the anterior chamber in homozygous (FP/; n = 8), heterozygous (FP+/; n = 14), and C57BL/6 background strain mice (FP+/+; n = 11). To confirm any differences in baseline IOP between genotypes, midafternoon IOP was also measured in a larger, separate group of FP/ mice (n = 20), FP+/ mice (n = 49), and FP+/+ (n = 23) wild-type littermates.
RESULTS. Trough IOPs were measured between 10 AM and 12 PM, peak IOPs were measured between 8 and 10 PM. For FP+/+, FP+/, and FP/ mice trough IOP was 16.2, 15.3, and 15.1 mm Hg and peak IOPs were 18.2, 18.4, and 17.7 mm Hg, respectively. There was no significant difference among genotypes for mean peak or mean trough IOP or for peak-trough difference in IOP among genotypes (P > 0.05, ANOVA). In addition, there was no significant difference in midafternoon IOP between genotypes in a larger population (n = 92) of FP-knockout and wild-type mice.
CONCLUSIONS. An intact FP receptor does not appear to be critical for normal 24-hour IOP regulation in the mouse eye.
The 24-hour variation in intraocular pressure (IOP) is a consistent phenomenon in humans and other mammals,1 but little is known of the molecular mechanisms that regulate this fluctuation. The recent development of accurate techniques for IOP measurement in wild-type and genetically modified mice permits evaluation of the role of individual genes in circadian IOP variation.1 2
The prostaglandin (PG) FP receptor is widely expressed in ocular tissues,3 4 5 but its function is poorly understood. PGF2
and many of its analogues bind the FP receptor and lower IOP in humans,6 nonhuman primates,7 rabbits,8 and mice.9 IOP lowering is consistent over the entire 24-hour period,10 11 12 and treatment is associated with a reduction in the 24-hour variation of IOP.11 It has recently been shown that PGF2
concentration in the aqueous humor of untreated rabbits exhibits circadian variation.13 Aqueous humor sampled during the light period, when IOP is low has significantly higher PGF2
levels than does aqueous taken during the dark phase, when IOP is higher. In contrast there is no significant variation in aqueous humor PGE2 concentration over the same time period.13 These findings raise the possibility that FP receptor activation by aqueous PGF2
has an important role in 24-hour IOP regulation.
We therefore hypothesized that mice lacking an intact FP receptor would have elevated IOP and increased 24-hour IOP variation compared with wild-type mice with intact FP receptors. The purpose of this study therefore was to compare IOP over the 24-hour circadian period in FP receptor knockout and wild-type mice.
 |
Methods
|
|---|
Animal Husbandry
All experiments were performed in compliance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Mice lacking the gene encoding the FP receptor were generated with a target vector (LacZ/Neo(r) that replaces the second exon of the FP gene (the generous gift of Shuh Narumiya Kyoto University, Japan). Homozygous knockout female mice fail to initiate parturition.14 For this reason, heterozygous (female) and homozygous (male) mating pairs were used to produce an F1 generation. C56BL/6 mice, which constitute the background strain, served as the control population. Mice were bred and housed in clear cages covered loosely with air filters containing white pine shavings for bedding. The environment was kept at 21°C. All mice were fed ad libitum. The animals ages ranged from 9 to 12 months.
Determination of Mouse Genotype
Mouse genotype was determined by polymerase chain reaction (PCR). DNA was extracted from 8-mm tail biopsy specimens of anesthetized adult mice (DNAeasy tissue kit, cat. no. 69504; Qiagen, Valencia, CA) according to the manufacturers guidelines. The oligonucleotide primers used to detect homologous translocation were: 5F (GCCCATCCTTGGACACCGAGA), 6R (AGAGTCGGCAAGCTGTGACTT) and NeoII (TGATATTGCTGAAGAGCTTGG). Amplification was performed over 35 cycles of 94°C for 30 seconds, 65°C for 30 seconds, and 75°C for 10 minutes. Products were analyzed by electrophoresis in 1% agarose gels. The PCR product sizes were 700 bp for FP and 450 bp, corresponding to the LacZ/neo(r) cassette. DNA of the heterozygous FP/ mice therefore produces two bands (700 and 450 bp), and that of homozygous FP/ knockout mice produce a single band (450 bp).
IOP Measurement
Mice were exposed to a 12-hour light (6 AM to 6 PM) and 12-hour dark cycle for at least 2 weeks before the experiments. Trough IOP was measured between 10 AM and 12 PM, and peak IOPs were measured between 8 and 10 PM, with minimum red-light illumination, as described previously.1
Cannulation IOP.
Measurements were performed by cannulation of the anterior chamber, as described in detail previously (Fig. 1) .15 Beveled microneedles were made of borosilicate glass with a tip diameter of 75 µm. The microneedle was mounted on a micromanipulator to enable accurate positioning and was connected to a pressure transducer (BLPR; World Precision Instruments, Sarasota, FL), which was calibrated against a manometer over the range of 0 to 30 mm Hg, as described previously.9 IOP was measured in both eyes within 7 minutes of the anesthetic administration. The second IOP was measured within 1 minute of the first eye recording. The investigator was masked to mouse genotype at the time of IOP measurement.

View larger version (160K):
[in this window]
[in a new window]
|
FIGURE 1. Cannulation (top) and rebound (bottom) tonometry in anesthetized mice. Both measurements were performed with a dissecting microscope and a micromanipulator, to improve measurement accuracy.
|
|
Induction-Impact (Rebound) Tonometry.
Longitudinal IOP measurements over a single 24-hour period were performed with an induction impact tonometer described by Danias et al.16 (Fig. 1) . This noninvasive tonometer permits IOP measurement in awake mice. The tonometer was calibrated in vivo, as described previously.17 A C57BL/6 mouse eye (background strain for FP receptor knockout mice) was cannulated close to the limbus with a needle connected to a fluid column and a pressure transducer. This setup permitted the eye pressure to be set by raising and lowering the fluid column. IOP measurements with the rebound tonometer were taken at intervals between 0 and 30 mm Hg. Longitudinal IOP measurement were made at 3-hour intervals in awake mice that were gently restrained to ensure no mechanical Valsalva effect that would elevate IOP. The tonometer probe was mounted on a micromanipulator, and measurements were recorded from a distance of 3.0 ± 0.1 mm from the center of the cornea. A dissecting microscope was used to ensure good centration on the cornea.
 |
Results
|
|---|
Baseline IOP
IOP was measured at the same time (between 2 and 4 PM) in a larger population of homozygous and heterozygous FP receptor knockout mice, as well as in the wild-type background strain, by using the cannulation technique (FP+/+, n = 23; FP+/, n = 49; FP/, n = 20). There was no statistically significant difference in IOP among the three genotypes (ANOVA; P > 0.05; Table 1 ).
Longitudinal IOP Measurement over 24 Hours
Calibration of the rebound tonometer in the C57BL/6 mouse provided a curvilinear calibration curve similar to that reported previously in Swiss White mice (Fig. 2) .17 This noninvasive tonometer permitted multiple longitudinal IOP measurements in the same awake mice over a single 24-hour period. The experiment determined whether there was any obvious difference in the 24-IOP profiles or time of peak and trough IOPs among genotypes. The 24-hour IOP profile revealed no obvious phase-shift in the 24-hour IOP profile among genotypes (Fig. 2) . For FP-knockout and wild-type mice, IOP was lower in the morning after onset of the light phase and increased after 6 PM with onset of the dark phase. No obvious difference was seen in the shape of the IOP profile between wild-type and homozygous FP-knockout mice.

View larger version (23K):
[in this window]
[in a new window]
|
FIGURE 2. Top: calibration curve for the rebound tonometer in a living wild-type (FP+/+) mouse. Bottom: 24-hour IOP profile in homozygous knockout (FP /; n = 4) and wild-type (FP+/+; n = 4) mice. IOP measurement was performed longitudinally over a single 24-hour period. Data points show mean IOP for the right eyes (±SEM).
|
|
Peak and Trough IOP
To determine the magnitude of IOP variation, peak and trough IOPs were measured between 10 AM and 12 PM and 8 and 10 PM by the cannulation method. The mean difference between trough and peak IOP was 1.8, 2.66, and 2.71 mm Hg in wild-type, heterozygous, and homozygous FP-knockout mice, respectively (Fig. 3) . There was no significant difference (P > 0.05, ANOVA) in trough or peak IOP between genotypes. Similarly, there was no statistically significant difference in mean IOP change (peak trough) between genotypes (P > 0.05, ANOVA).

View larger version (24K):
[in this window]
[in a new window]
|
FIGURE 3. (A) Peak and trough IOP for FP+/+ (n = 11), FP+/ (n = 14), and FP/ (n = 8) mice. Data shown represents mean IOP ± SEM. (B) Difference in mean peak and trough IOP (peak trough ± SEM).
|
|
Limits of Detection
The limit of detectable differences was calculated from the SD of mean IOP and the number of mice for right eye IOP measurements (StatMate; GraphPad Software Inc., San Diego, CA). For baseline IOP measurements, the study had an 80% power of detecting a minimum difference in IOP of 1.5 mm Hg between wild-type and homozygous FP-knockout mice and a minimum difference of 1.4 mm Hg between heterozygous and homozygous FP-knockout mice. For trough and peak measurements, the study had an 80% power to detect a minimum IOP difference between wild-type and homozygous mice of 2.3 mm Hg for trough IOP measurements and 2.8 mm Hg for peak IOP measurements.
 |
Discussion
|
|---|
These data demonstrate that there was no detectable difference in 24-hour IOP measurement between FP receptorknockout and wild-type mice with intact FP receptors. Mice of both genotypes had lower IOPs in the early light phase and higher IOP in the early dark phase. These changes are similar to those reported previously in NIH Swiss White mice. The data indicate that an intact FP receptor is not critical for normal-appearing 24-hour IOP regulation in the mouse eye.
The human and mouse eye share several similarities with respect to aqueous humor dynamics. Both species have well-defined trabecular and uveoscleral outflow pathways, and aqueous humor turnover is
2.5% for both species.15 An important difference is the larger proportion of total outflow that passes via the uveoscleral outflow pathway in the mouse eye. Recent calculations based on the measurement of total outflow facility, episcleral venous pressure (EVP) and aqueous flow using the Goldmann equation indicated that
80% of aqueous humor outflow passes though the uveoscleral pathway in the mouse.15 It is not known whether differences in the proportion of uveoscleral flow between mice and humans influences the relative contribution of the FP receptor to 24-hour IOP variation. We have previously demonstrated that prostaglandin FP-knockout mice have normal anterior segment anatomy and do not respond to topical PGF2
analogues.18 19 In comparison, wild-type mice responded to topical prostaglandins with a significant decline in IOP, indicating that FP receptor signaling lowers IOP in the mouse. We recently reported baseline (midafternoon) IOPs in a smaller cohort of FP-knockout mice. These data suggested a trend for increased IOP in FP-knockout mice compared with wild-type mice.18 The finding was not confirmed in the present study where midafternoon IOPs were measured in a larger number of FP-knockout and wild-type mice. The current findings are also in agreement with those in the recent study by Ota et al.,20 who reported no difference in IOP between homozygous FP-knockout and wild-type mice.
Two IOP measurement techniques were used in this study: (1) cannulation of the anterior chamber with a fine needle attached to a pressure transducer and (2) a noninvasive rebound tonometer. A detailed comparison of these measurement techniques in NIH Swiss White mice has been reported by our group recently.17 Using these methods, we found no difference in the shape of 24-hour IOP variation or the magnitude of IOP variation between homozygous knockout and wild-type mice. The magnitude of 24-hour IOP variation was greater, however, for both genotypes when IOP was measured with the rebound tonometer compared with IOP variation as measured by cannulation. This result is most likely a reflection of the reduced accuracy of our rebound tonometer for measuring higher IOPs, perhaps due to the curvilinear calibration curve obtained for both NIH Swiss White mice and the C57BL/6 wild-type mice used in this study. In consideration of this, we elected to measure peak and trough values by using the cannulation method. The disadvantage of this approach was that general anesthesia was required and longitudinal IOP measurement was not possible. A minimum of 1 weeks separation between consecutive IOP measurements was used to permit sealing of the corneal wound and resolution of any potential inflammation that may have occurred. It has been demonstrated previously that the IOP is minimally affected by ketamine-xylazine anesthesia in the first 8 minutes after intraperitoneal injection of anesthetic. All cannulation IOP measurements in this study were performed within 7 minutes of anesthetic administration. Another source of the greater variability of the rebound tonometer is that gentle restraint is required to perform rebound tonometry in the awake mouse. Therefore, it is possible that variable stress or a Valsalva-induced IOP increase occurred during IOP measurement. We believe that a Valsalva effect is unlikely, however, as the IOPs obtained by rebound tonometry were not consistently higher during the 24-hour period. In addition, evaluation of different restraint techniques performed before this study indicated that manual restraint induced less IOP elevation compared with a Decapicone (Braintree Scientific, Braintree, MA) or a custom-built restraint device. Despite the increase in IOP range, rebound tonometry performed longitudinally over a single 24-hour period demonstrated that there was no difference in the shape of the 24-hour IOP profile between wild-type and knockout mice.
In the present study, mice lacking an intact FP receptor did not have significantly different IOP or 24-hour IOP variation than did wild-type mice. An intact FP receptor therefore does not appear to be essential for a normal-appearing 24-hour IOP variation in the mouse eye. Further studies may clarify whether this reflects a lack of involvement of the FP receptor, or the presence of a compensatory mechanism that maintains IOP variation when the FP receptor is absent.
 |
Footnotes
|
|---|
Supported in part by the National Eye Institute EY05990 (RNW).
Submitted for publication May 9, 2006; revised September 24 and October 24, 2006; accepted March 7, 2007.
Disclosure: J.G. Crowston, None; C.A. Morris, None; J.D. Lindsey, None; R.N. Weinreb, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: Robert N. Weinreb, Hamilton Glaucoma Center, University of California San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0946; weinreb{at}eyecenter.ucsd.edu.
 |
References
|
|---|
- Aihara M, Lindsey JD, Weinreb RN. Twenty-four-hour pattern of mouse intraocular pressure. Exp Eye Res. 2003;77:681686.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Savinova OV, Sugiyama F, Martin JE, et al. Intraocular pressure in genetically distinct mice: an update and strain survey. BMC Genet. 2001;2:12.[Medline][Order article via Infotrieve]
- Ocklind A, Lake S, Wentzel P, Nister M, Stjernschantz J. Localization of the prostaglandin F2 alpha receptor messenger RNA and protein in the cynomolgus monkey eye. Invest Ophthalmol Vis Sci. 1996;37:716726.[Abstract/Free Full Text]
- Anthony TL, Pierce KL, Stamer WD, Regan JW. Prostaglandin F2 alpha receptors in the human trabecular meshwork. Invest Ophthalmol Vis Sci. 1998;39:315321.[Abstract/Free Full Text]
- Anthony TL, Lindsey JD, Aihara M, Weinreb RN. Detection of prostaglandin EP, EP, and FP receptor subtypes in human sclera. Invest Ophthalmol Vis Sci. 2001;42:31823186.[Abstract/Free Full Text]
- Giuffre G. The effects of prostaglandin F2 alpha in the human eye. Graefes Arch Clin Exp Ophthalmol. 1985;222:139141.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Nilsson SF, Samuelsson M, Bill A, Stjernschantz J. Increased uveoscleral outflow as a possible mechanism of ocular hypotension caused by prostaglandin F2alpha-1-isopropylester in the cynomolgus monkey. Exp Eye Res. 1989;48:707716.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Camras CB, Bito LZ, Eakins KE. Reduction of intraocular pressure by prostaglandins applied topically to the eyes of conscious rabbits. Invest Ophthalmol Vis Sci. 1977;16:11251134.[Free Full Text]
- Aihara M, Lindsey JD, Weinreb RN. Reduction of intraocular pressure in mouse eyes treated with latanoprost. Invest Ophthalmol Vis Sci. 2002;43:146150.[Abstract/Free Full Text]
- Racz P, Ruzsonyi MR, Nagy ZT, Gaygi Z, Bito LZ. Around-the-clock intraocular pressure reduction with once-daily application of latanoprost by itself or in combination with timolol. Arch Ophthalmol. 1996;114:268273.[Abstract/Free Full Text]
- Orzalesi N, Rossetti L, Invernizzi T, Bottoli A, Autelitano A. Effect of timolol, latanoprost, and dorzolamide on circadian IOP in glaucoma or ocular hypertension. Invest Ophthalmol Vis Sci. 2000;41:25662573.[Abstract/Free Full Text]
- Liu JH, Kripke DF, Weinreb RN. Comparison of the nocturnal effects of once-daily timolol and latanoprost on intraocular pressure. Am J Ophthalmol. 2004;138:389395.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Liu JH. Circadian variations of prostaglandins in the rabbit aqueous humor. J Ocul Pharmacol Ther. 2000;16:4954.[Web of Science][Medline][Order article via Infotrieve]
- Sugimoto Y, Yamasaki A, Segi E, et al. Failure of parturition in mice lacking the prostaglandin F receptor. Science. 1997;277:681683.[Abstract/Free Full Text]
- Aihara M, Lindsey JD, Weinreb RN. Aqueous humor dynamics in mice. Invest Ophthalmol Vis Sci. 2003;44:51685173.[Abstract/Free Full Text]
- Danias J, Kontiola AI, Filippopoulos T, Mittag T. Method for the noninvasive measurement of intraocular pressure in mice. Invest Ophthalmol Vis Sci. 2003;44:11381141.[Abstract/Free Full Text]
- Morris CA, Crowston JG, Lindsey JD, Danias J, Weinreb RN. Comparison of invasive and noninvasive tonometry in the mouse. Exp Eye Res. 2006;82:10941099.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Crowston JG, Lindsey JD, Aihara M, Weinreb RN. Effect of latanoprost on intraocular pressure in mice lacking the prostaglandin FP receptor. Invest Ophthalmol Vis Sci. 2004;45:35553559.[Abstract/Free Full Text]
- Crowston JG, Lindsey JD, Morris CA, Wheeler L, Medeiros FA, Weinreb RN. Effect of bimatoprost on intraocular pressure in prostaglandin FP receptor knockout mice. Invest Ophthalmol Vis Sci. 2005;46:45714577.[Abstract/Free Full Text]
- Ota T, Aihara M, Narumiya S, Araie M. The effects of prostaglandin analogues on IOP in prostanoid FP-receptor-deficient mice. Invest Ophthalmol Vis Sci. 2005;46:41594163.[Abstract/Free Full Text]