|
|
||||||||
1From the The Schepens Eye Research Institute, Department of Ophthalmology, Harvard Medical School, Boston Massachusetts; 2Schepens Retina Associates Foundation, Boston, Massachusetts; and 4ZymoGenetics, Seattle, Washington.
| Abstract |
|---|
|
|
|---|
receptor (PDGFR
) is dramatically more capable of promoting PVR than is closely related PDGFRß. To test the ligand hypothesis (i.e., that this phenomenon can be explained by a predominance of PDGFR
-specific ligands) this study was conducted to determine the profile of PDGF ligands expressed by cells that induce PVR and in the vitreous of rabbits that have PVR. In addition, we examined which PDGF isoforms were present in the vitreous of patients with PVR, to assess the relevance of the rabbit model to the clinical setting.
METHODS. PDGF isoforms were detected and quantified by Western blot analysis and ELISA. An assay was performed of conditioned medium from mouse embryo fibroblasts expressing the PDGFR
(F
) and rabbit conjunctival fibroblasts (RCFs), both of which cause PVR in the experimental model, and from human retinal pigment epithelial cells (ARPE-19). Because PDGF-C is secreted in a latent form and must be proteolytically processed to become biologically active, a PDGF-C processing assay was established, and conditioned medium was tested from these cells lines, for processing activity. Vitreous specimens, from control and PVR rabbits and from patients undergoing vitrectomy surgery, either to repair retinal detachment or for other reasons, were also tested for PDGF isoforms and for PDGF-C processing activity.
RESULTS. PDGF isoforms that activate PDGFRß (PDGF-B and -D) were either undetectable or were present at very low levels in all the samples tested. Relatively low levels of PDGF-A and -AB were detected, whereas PDGF-C was the predominant isoform. F
, RCFs, and ARPE-19 cells accumulated PDGF-C in the conditioned medium at an average rate of 2.0 ± 0.2, 2.9 ± 0.3, and 71.3 ± 6.0 ng/mL per day, respectively. Although there was no detectable PDGF-C in the vitreous of control rabbits (n = 8), there was an average of 1784 ± 1150 ng/mL latent PDGF-C in the vitreous from rabbits with PVR (n= 14). Of the patients with PVR, eight of nine contained PDGF-C (range, 501000 ng/mL). In contrast, PDGF-C was detected in only 1 of 16 of the patients without PVR. In both conditioned medium and vitreous samples, the latent (instead of the active) form of PDGF-C was detected, even though processing activity was present in all the samples tested.
CONCLUSIONS. The predominance of PDGF isoforms that activate PDGFR
support the ligand hypothesis as an explanation of why PDGFR
is more capable of inducing PVR than is PDGFRß. Furthermore, the profile of PDGF isoforms observed in the rabbit model accurately reflected the clinical specimens from patients with PVR. Finally, these findings implicate one of the new PDGF family members as an important contributor to experimental and clinical PVR.
There is both indirect and direct evidence supporting the idea that growth factors play a key role in PVR. Indirect evidence includes the fact that growth factors promote cellular responses that are integral to PVR, such as proliferation, migration, and contraction. In addition, growth factors accumulate in the vitreous of patients with PVR, and the cells within the PVR membrane secrete and/or respond to these growth factors.5 6 7 8 9 10 11 12 13 14 15 16 17
Direct support of the role of growth factors comes from work in animal models of PVR. Immortalized mouse embryo fibroblasts failed to induce PVR effectively, unless they expressed receptors for platelet-derived growth factor (PDGF).18 Systematic comparison of cells harboring different PDGF receptors revealed that cells expressing the PDGF
receptor (PDGFR
) induced PVR, whereas PDGF ß receptor (PDGFRß)expressing cells did not. Thus, PDGF is essential in experimental PVR. In addition, these findings revealed that the type of receptor expressed by cells can determine their potential to induce PVR. These studies also established an experimental model to investigate why expression of different PDGFRs have such a profound impact on the manifestation of PVR.
In the PDGF family, there are four gene products that assemble into five dimeric isoforms: PDGF-A, -AB, -B, -C, and -D.19 20 PDGF-A, -AB and -B undergo intracellular processing and activation during transport in the exocytic pathway, whereas the novel PDGFs, PDGF-C and -D, are secreted in a latent state that requires activation by extracellular proteases. The proteases responsible for activating the new PDGF family members are actively being investigated. Whereas plasmin is capable of producing active PDGF-C, tissue plasminogen activator (tPA) appears to the physiologically relevant activator of PDGF-C.19 21 22 23 The proteases known to process PDGF-D are plasmin and urokinase plasminogen activator.20 24 25
The inherent selectivity of PDGF isoforms for different PDGFRs is the basis for the ligand hypothesis as a potential explanation of why cells expressing PDGFR
have a much higher PVR potential than do cells harboring PDGFRß. Cells that have only PDGFRß can be activated by PDGF-B and -D.19 In contrast, PDGFR
-expressing cells can be activated by all PDGF ligands except for PDGF-D, which is specific for the PDGFRß.19 20 The ligand hypothesis states that PDGFR
-expressing cells are better at causing PVR because one or more of the ligands that preferentially activate PDGFR
(PDGF-A, -C or -AB) predominate in the vitreous of the PVR state.
To test the ligand hypothesis, we sought to determine which isoforms of PDGF are secreted by cells associated with PVR and accumulate in the vitreous of rabbits with PVR. Both fibroblasts and RPE cells secreted PDGFR
-specific ligands, especially PDGF-C. In addition, there were large amounts of PDGF-C in the vitreous of rabbits with PVR. These observations strongly support the ligand hypothesis. Finally, our findings obtained with this experimental model were consistent with the clinical setting. PDGF-C was present in the vitreous of nearly all patients with PVR, whereas PDGF-C was detected in only a minority of patients undergoing retinal surgery for reasons unrelated to PVR.
| Materials and Methods |
|---|
|
|
|---|
had been re-expressed (F
cells) were derived as previously described.18 The human retinal pigment epithelial cell line ARPE-19 (RPE) was purchased from American Type Culture Collection (ATCC, Manassas, VA). Primary rabbit conjunctiva fibroblasts (RCFs) were isolated from rabbit conjunctiva as previously described.18 The F
cells and RCFs were maintained in Dulbeccos modified Eagles medium (DMEM, high glucose; Invitrogen-Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum (FBS; Gemini Bio Products, Calabasas, CA), 500 U/mL of penicillin, and 500 µg/mL of streptomycin. RPE cells were cultured in a 1:1 mixture of DMEM and Hams F12 medium (Invitrogen-Gibco) supplemented with 10% FBS, 500 U/mL of penicillin, and 500 µg/mL of streptomycin. The cells were cultured at 37°C in a humidified 5% CO2 atmosphere. The following protocol was used to produce conditioned medium (CM). After the cells grew to approximately 90% confluence, they were rinsed once with phosphate-buffered saline (PBS), and the medium was replaced with serum-free DMEM or a 1:1 mixture of DMEM and Hams F12. The general viability of the cells was monitored by observation under a light microscope, and medium was collected at different time points (days 1, 2, and 5 and weeks 1 and 2) from cells that appeared healthy. The harvested medium was centrifuged for 10 minutes at 2000 rpm and the supernatant was frozen until analysis.
Reagents
The rabbit anti-PDGF-C core domain antibody was produced by immunizing New Zealand White rabbits with the peptides 3-3 (residues 299-326) and purified with a peptide-affinity column.22 Goat anti-PDGF-D and anti-PDGF-C antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The goat anti-PDGF-A, -AB, and -B antibody was from Upstate Biotechnology (Lake Placid, NY). The two anti-PDGFR
antibodies (27P and 80.8) were produced and characterized as previously described.26 The two anti-phosphotyrosine antibodies, 4G10 and PY20, were purchased from Upstate and BD-Transduction Laboratories (Lexington, KY), respectively. Tissue plasminogen activator (tPA) was purchased from Sigma-Aldrich (St. Louis, MO); a tPA inhibitor (tPA-STOP) was from American Diagnostica, Inc. (Stamford, CT). Recombinant human PDGF-A and -B were purchased from Peprotech, Inc. (Rocky Hill, NJ), and recombinant human PDGF-C core domain was prepared as previously described.22
Rabbit Model of PVR and Preparation of Rabbit Vitreous
Rabbits (Dutch belted) were purchase from Covance (Denver, PA). PVR was induced in the right eye, as previously described.18 27 Briefly, gas vitrectomy was performed by injecting 0.1 mL of perfluoropropane (C3F8) into the vitreous cavity 4 mm posterior to the corneal limbus. One week later, all rabbits were injected with 0.1 mL of PRP (platelet-rich plasma). PRP was prepared as described previously.18 In addition, the rabbits were injected with 0.1 mL DMEM (8 rabbits; control group) or 2 x 105 RCFs in 0.1 mL DMEM (14 rabbits, PVR group). The retinal status was evaluated with an indirect ophthalmoscope fitted with a +30-D fundus lens at days 1, 4, 7, 14, 21, and 28 after surgery. PVR was graded according to the Fastenberg classification from 0 through 5.28 On day 28, the animals were killed, the eyes were enucleated and frozen at 80°C. All surgeries were performed in aseptic conditions and pursuant to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The protocol for the use of animals was approved by the Schepens Animal Care and Use Committee.
To prepare the rabbit vitreous, we dissected it from the eyeball while it was still frozen, permitted it to thaw, and then centrifuged it at 4°C for 5 minutes at 10,000g. The resulting supernatant was used for all analyses.
Patient Vitreous
All human vitreous specimens were obtained from patients of Schepens Retina Associates who were undergoing vitrectomy surgery at Massachusetts Eye and Ear Infirmary (MEEI), in Boston, Massachusetts. IRB approval to perform these studies was obtained (protocol 05-03-019X, "Assay of Human Vitreous for Activity that Processes PDGF-C") before undertaking any of the experiments. The reasons for surgery were varied (e.g., PVR, macular hole, vitreous hemorrhage, dropped lens, retinal detachment, and retinoschisis), and patients provided consent for specimen donation in a consecutive fashion, regardless of preoperative diagnosis. Those patients who did not have PVR (n = 16) served as control subjects for those who did (n = 9). Vitreous biopsies were obtained at the outset of vitrectomy surgery, immediately after the vitrectomy cutting instrument was inserted, but before the infusion was turned on. For the eyes that had already undergone vitrectomy, vitreous fluid of 0.2 mL was drawn from the central portion of the vitreous cavity by using a TB syringe with a 30-gauge needle before the infusion cannula was opened. The samples thus obtained represent the undiluted initial material obtained from a core vitrectomy. This method did not significantly alter the normal procedure, nor did the patients assume any additional risk by their donation of the specimen. The research adhered to the tenets of the Declaration of Helsinki.
Expression and Purification of GST-PDGF-C
The full-length human PDGF-C cDNA (1038 bp) was amplified by polymerase chain reaction (PCR) using Pfu polymerase (Stratagene, La Jolla, CA) under standard conditions. Primers used for amplifying PDGF-C were: sense 5' CTTTGGATCCGCTCCTCCTCGGCCTCCTC, including a BamHI site for in-frame cloning, and antisense 5' ACTAGAATTCTTACCCTCCTGCGTTCC, including an EcoRI site. These primers were synthesized by MWG Biotech (High Point, NC). The amplified fragments were digested with BamHI and EcoRI and cloned into prokaryotic expression vector pGEX-1 (GE Healthcare, Piscataway, NJ). Constructs were verified by nucleotide sequencing at the Massachusetts General Hospital DNA core facility (Cambridge, MA). The glutathione S-transferase (GST)-PDGF-C fusion protein was induced with isopropyl-ß-D-thiogalactoside (IPTG; 0.5 mM), and it accumulated in inclusion bodies. GST-PDGF-C was purified and refolded as previously described.29 The purified fusion proteins were dialyzed into PBS at 4°C overnight. The proteins were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and the resultant gels were stained with Coomassie brilliant blue; the purity of GST-PDGF-C was no less than 95%.
Partial Proteolysis
We compared the native and recombinant GST-PDGF-C by partial proteolysis. The source of native PDGF-C was RPE CM (60 µL/sample). The same volume of CM from RPE cells in which PDGF-C expression, suppressed with small interfering (si)RNA oligos, was added to 18 ng of GST-PDGF-C. Proteases (0.1 µg of trypsin or chymotrypsin) were added and incubated at 37°C for 5 minutes, and then the samples were subjected to a PDGF-C Western blot using the antibody that recognizes the core domain.
To suppress PDGF-C expression, we used siRNA sequence selector software (BD Biosciences, Palo Alto, CA), and selected three target sequences specific for human PDGF-C (GenBank accession NM_016205) (1) GCTTGAAGACCCAGAAGAT (bp 775-793), (2) GCCACAATTCACAGAAGCT (bp 982-1000), and (3) TGCACACCTCGTAACTTCT (bp 1238-1256). The corresponding oligonucleotides, flanked with BamHI and EcoRI, were subcloned into a retroviral vector (RNAi-Ready pSIREN-RetroQ; BD Biosciences). The siRNA retroviruses were generated as described.30 As judged by anti-PDGF-C Western blot analysis of the CM, PDGF-C expression was suppressed by 93.5% ± 1.5% in the cells that stably expressed the siRNA oligo 1.
PDGF-C Processing Assay
PDGF-C processing activity was assayed as follows. Samples to be tested (CM, 20 µL; rabbit vitreous, 1 µL; and patient vitreous, 5 µL) were incubated with 50 ng GST-PDGF-C in PBS for 0.5, 2, 4, 8, 12, and 20 hours at 37°C. The total reaction volume was 40 µL. The positive control for these experiments was tPA (3 µL, 0.5 µM). The input consisted of an equivalent amount of GST-PDGF-C that was treated identically, except that it was not incubated with CM or vitreous. After the incubations, the proteins were resolved by reducing SDS-PAGE and then were immunoblotted with a goat anti-PDGF-C core domain antibody (Santa Cruz Biotechnology). These pilot experiments indicated that a 12-hour incubation period was optimal, which was used in all processing assays, unless indicated otherwise.
To assess the extent to which tPA contributed to the processing activity, we performed all assays in the presence or absence of the tPA inhibitor (tPA-STOP; American Diagnostica). Experimental samples were preincubated with the tPA inhibitor (50 µM) for 2 hours before the standard processing assay was performed.
Immunoprecipitation and Immunoblot Analysis
F
cells were grown to 90% confluence and then incubated for 24 hours in DMEM without serum. The desired agents were added for 5 minutes at 37°C, the cells were washed twice with H/S (20 mM HEPES [pH 7.4], 150 mM NaCl), and then lysed in EB (10 mM Tris-HCl [pH 7.4], 5 mM EDTA, 50 mM NaCl, 50 mM NaF, 1% Triton X-100, 20 µg/mL aprotinin, 2 mM Na3VO4, and 1 mM phenylmethylsulfonyl fluoride). Lysates were centrifuged for 15 minutes at 13,000g, and PDGFR
was immunoprecipitated from 1.5 mg clarified lysate, as previously described,26 except that protein A Sepharose was used to collect the immune complexes instead of Staphylococcus aureus membranes. The immunoprecipitating antibody was a crude rabbit polyclonal (27P). The blotting antibody was the mixture of anti-phosphotyrosine antibodies (4G10/PY20). The primary blot was stripped and reprobed with a mixture of two PDGFR
antibodies (27P and 80.8). The extent of phosphorylation was analyzed by densitometry (Quantity One software; Bio-Rad, Hercules, CA) and normalized for the amount of PDGFR
in each sample.
The amount of PDGF-C, -A, -AB, -B, and -D in the CM, rabbit vitreous, and human vitreous was determined by Western blot by comparison with positive control samples (5, 10, 20, 40 ng) of GST-PDGF-C, GST-PDGF-D, and PDGF-A, and -B.
Experimental samples (40 µL of unconcentrated [RPE, RCF] or concentrated [F
] CM, 5 µL of rabbit vitreous, and 20 µL patient vitreous) were subjected to reducing (PDGF-C and -D) or unreducing (PDGF-A, -AB, and -B) SDS-PAGE and then immunoblotted with the PDGF antibodies described earlier. The resultant data were quantified densitometrically (Quantity One; BD Bioscience). A nanogram level of the amount of PDGF was determined by comparison with the signal intensity of known quantities of PDGF that were analyzed in parallel.
Enzyme-Linked Immunosorbent Assay
ELISAs were developed to detect and quantify PDGF-A, -AB, -B, -C, and -D. The antibodies were tested for cross-reactivity to other PDGF isoforms before their use in the ELISA assay. The monoclonal antibodies against PDGF-C reacted only with the core domain of PDGF-C, whereas the antibody against PDGF-D recognized both the full-length and the core domain of PDGF-D. Isoform-specific monoclonal antibodies were coated onto 96-well microtiter plates at 1 µg/mL in 0.1 M Na2HCO3 (pH 9.6) and incubated overnight at 4°C. The plates were washed with PBS containing 0.05% Tween-20, then blocked with blocking buffer (PBS containing 1% BSA and 0.05% Tween-20) for 2 hours at 37°C. PDGF standards and test samples were diluted in blocking buffer, added to appropriate plates and incubated for 1 hour at 37°C. For PDGF-C and -D ELISA, the plates were washed and incubated with a ligand-specific, biotinylated secondary monoclonal antibody at 0.5 µg/mL for 1 hour at 37°C. The plates were washed and incubated with streptavidin conjugated to horseradish peroxidase (Pierce, Rockford, IL) at 0.5 µg/mL, diluted in blocking buffer. For PDGF-A and -AB ELISAs, a rabbit anti-A chain polyclonal antibody was added at 1 µg/mL to wells for 1 hour at 37°C. For the PDGF-B ELISA, a rabbit anti-B chain polyclonal antibody was added at 1 µg/mL to wells for 1 hour at 37°C. The plates were washed and incubated with goat anti-rabbit IgG conjugated to horseradish peroxidase (Biosource, Camarillo, CA). After a final wash, all plates were incubated with TMß substrate (BioFx, Owings Mills, MD) for 5 minutes at ambient temperature. The reaction was blocked by addition of a blocking reagent (TMß 450; BioFx) and read at an absorbance of 450 nm in an ELISA plate reader (SpectraMax 340; Invitrogen-Molecular Devices, Sunnyvale, CA).
The ELISA sensitivity approximations are 1 ng/mL for all isoforms except PDGF-B, for which the lower limit of detection was 0.1 ng/mL. Each experimental sample was analyzed at two dilutions in duplicate.
| Results |
|---|
|
|
|---|
Cell Secretion and Processing of PDGF-C
, but not PDGFRß.18 The explanation provided by the ligand hypothesis is that F cells secrete and/or the vitreous accumulates PDGF isoforms that are specific for PDGFR
and thereby establish an autocrine loop in F cells expressing PDGFR
(F
cells). To test this hypothesis, we used two different experimental approaches (Western blot analysis and ELISA) to assess the profile of PDGF isoforms secreted by F
cells. PDGF-C was the only isoform that we detected by either approach (Fig. 1 , Table 1 , and data not shown), and it accumulated in the medium of F
cells at an average rate of 2.2 ± 0.2 ng/mL per day. It is possible that other PDGF isoforms were present, yet below the level of detection, which was 25 ng for PDGF-A, 20 ng for PDGF-B, and 10 ng for PDGF-D for the Western blot. For the ELISA the detection limit was approximately 1 ng/mL for PDGF-A, AB, -C, and -D and 0.1 ng/mL for PDGF-B. Our observation, that under basal conditions fibroblasts secreted PDGF-C but not the other PDGF isoforms, is consistent with reports from several other laboratories.21 22 31
|
|
cells was latent or active. The molecular mass of PDGF-C indicated that it was the latent form (Fig. 1A) . We detected the core domain (the active form) in only two of six experiments. The probable reason for this is instability of the core domain in CM (see below). We conclude that the latent form of PDGF-C accumulated in the CM of F
cells. This conclusion was indirectly supported by the fact that PDGF-C was not detected in the ELISA, which does not recognize the latent form of PDGF-C.
Because fibroblasts express tPA, which processes PDGF-C,19 20 23 we investigated whether F
cells were capable of processing latent PDGF-C to its active form. For these studies we generated and characterized recombinant, full-length PDGF-C in the context of a GST fusion protein. Because the recombinant PDGF-C was fused with the 26-kDa GST domain, it had a higher mass than the native protein (Fig. 1) . Despite this difference in mass, partial proteolysis of the two proteins resulted in fragments of the same size (Fig. 1B , asterisks). This was true when using either of two proteases. This result indicated that the two proteins had the same sensitivity to proteolysis and strongly suggested that they were folded comparably. Furthermore, the molecular mass of PDGF-C was approximately two times greater under nonreducing versus reducing conditions (Fig. 1C) , which is consistent with the disulfide-mediated dimeric nature of PDGF-C.19 20 23 Additional support for the idea that recombinant GST PDGF-C was properly folded was the fact that it was not recognized in the active form-specific PDGF-C ELISA until it was processed (data not shown) and that it activated the PDGFR
after processing (Fig. 2C) . We then proceeded to use the GST-PDGF-C in the processing assay. As expected, tPA reduced the amount of the full-length GST-PDGF-C, and processing was efficiently inhibited by a tPA inhibitor (tPA-STOP). Under these conditions, we detected the core domain, and similar amounts were produced from either native or recombinant GST-PDGF-C (Fig. 1C) . We repeated the processing assay with recombinant GST-PDGF-C as a substrate, by using F
CM instead of purified tPA, and observed comparable results (Fig. 2B) . The only difference was that the tPA blocking agent (tPA STOP; American Diagnostica) stopped an average of 63.7% ± 4.5% of the processing (instead of 97.5% ± 0.6%) suggesting that the CM contained proteases other that tPA that are capable of processing PDGF-C. Taken together, these data revealed that recombinant GST-PDGF-C was a suitable substrate for the processing assay, that F
cells were capable of processing PDGF-C, and that most of the activity in the CM of F
cells was tPA.
|
To test whether the core domain produced by processing of full-length PDGF-C was functionally active, we tested its ability to induce tyrosine phosphorylation of PDGFR
. We included both native and recombinant GST-PDGF-C in this series of experiments. Cells expressing PDGFR
were exposed to processed or unprocessed PDGF-C. PDGFR
was immunoprecipitated and subjected to an anti-phosphotyrosine Western blot analysis. As shown in Figure 2C , full-length PDGF-C was unable to promote phosphorylation of PDGFR
, regardless of whether it was native or recombinant (lanes 3 and 5). In contrast, processed PDGF-C activated PDGFR
, and the native and recombinant forms had similar potency (Fig. 2C , compare lanes 2 and 4). We conclude that F
cells secrete both PDGF-C and the proteases necessary to process it to its active form.
RPE and RCF Cell Secretion and Processing of PDGF-C
We extended our analysis of PDGF isoforms to two additional cell types that are highly relevant to PVR. RPE cells, which are the most abundant cell type in human PVR membranes, and rabbit conjunctival fibroblasts (RCFs), the most commonly used cell type in the rabbit PVR model. As shown in Figure 3 , the properties of these two cell types were very similar to those of the F
cells. They secreted PDGF-C and the latent form accumulated in the media. RPE and RCF cells accumulated PDGF-C at an average rate of 71.3 ± 6.0 and 2.9 ± 0.3 ng/mL per day, respectively. Furthermore, there was processing activity in the CM, and the majority (although not all of it) was blocked by the tPA blocking agent (tPA-STOP; American Diagnostica). The other PDGF isoforms were either below the level of detection or present much lower levels than PDGF-C (Table 1 and data not shown).
|
, and that PDGF-C was the most dramatically increased.
|
|
|
|
| Discussion |
|---|
|
|
|---|
Although our findings clearly promote the ligand hypothesis, they do not address the possibility that there are differences in the signaling output of PDGFR
and PDGFRß, which contribute to the increased PVR potential of PDGFR
. Although the intracellular domain of these two receptors are highly homologous and engage many of the same signaling pathways,32 33 they arise from different genes and are not fully interchangeable during development.34 Thus, it is possible that being awash in PDGF-C is not the only reason F
cells induce PVR significantly better than do Fß cells. PDGFR
may also trigger signaling events that promote PVR. We plan to address this signaling hypothesis by testing the PVR potential of cells expressing a PDGFR chimera that responds to PDGFR
ligands and signals through a PDGFRß cytoplasmic domain.
Numerous groups have reported that PDGF is elevated in the vitreous of patients with PVR and/or is expressed by RPE and glial cells within PVR membranes.7 8 9 10 11 12 14 15 16 17 These previous studies focused on the original members of the PDGF family (PDGF-A, -AB, and -B). The findings in this study are consistent with these earlier reports and extend the analysis to include PDGF-C and-D, the newly appreciated family members. We found that there was much more PDGF-C than any of the other isoforms of PDGF. Although we cannot exclude the possible involvement of the other forms of PDGF (or other growth factors in the vitreous and membrane), the predominance of the PDGF-C isoform identifies it as the most logical therapeutic target.
We were surprised to find such high levels of PDGF-C in the vitreous of rabbits with severe PVR. It takes 10 to 20 ng/mL of PDGF-C to induce responses such as contraction or proliferation, and the level detected in experimental and clinical PVR was typically in vast excess of this value. The presence of processing activity indicates that at least some of this pool of latent PDGF-C was being converted to the active form. Therefore, the amount of latent PDGF-C being synthesized was probably even greater than the amount observed. At the present time we do not know if all PDGF-C is coming from the injected cells. Although we originally expected that the platelet-rich plasma (which is co-injected with the cells to induce PVR) would be a major source of PDGF, PDGF-C was not detected in the vitreous from control rabbits, which were injected only with PRP. In light of our findings, we speculate that the injected cells are the primary source of PDGF-C; ongoing experiments to stably silence the expression of PDGF-C in cells before injecting them will provide a better understanding of this issue.
Of note is the observation that the amount and nature of the processing activity was changed by PVR in rabbits. A simple explanation of this phenomenon is that PVR increased the amount of tPA, which would increase the overall activity and overwhelm the tPA blocking agent added to the reactions. However, pilot experiments indicated that we were using saturating amounts of inhibitor, and that the amount of tPA present in vitreous samples was very low (data not shown). These observations suggest that PVR induces the expression and/or activity of PDGF-C-processing proteases that are not tPA.
Finally, our studies beg the question of whether interfering with the production, processing or function of PDGF-C could prevent PVR. Our ongoing studies are directed toward addressing this question.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by National Eye Institute Grant EY012509 (AK).
Submitted for publication August 14, 2006; revised November 14 and December 27, 2006; accepted March 21, 2007.
Disclosure: H. Lei, None; P. Hovland, None; G. Velez, None; A. Haran, ZymoGenetics (E); D. Gilbertson, ZymoGenetics (E); T. Hirose, None; A. Kazlauskas, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: Andrius Kazlauskas, Schepens Eye Research Institute, Harvard Medical School, 20 Staniford Street, Boston, MA 02114; ak{at}eri.harvard.edu.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Lei, G. Velez, P. Hovland, T. Hirose, D. Gilbertson, and A. Kazlauskas Growth Factors Outside the PDGF Family Drive Experimental PVR Invest. Ophthalmol. Vis. Sci., July 1, 2009; 50(7): 3394 - 3403. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lei and A. Kazlauskas Growth Factors Outside of the Platelet-derived Growth Factor (PDGF) Family Employ Reactive Oxygen Species/Src Family Kinases to Activate PDGF Receptor {alpha} and Thereby Promote Proliferation and Survival of Cells J. Biol. Chem., March 6, 2009; 284(10): 6329 - 6336. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. He, Y. Chen, R. Khankan, E. Barron, R. Burton, D. Zhu, S. J. Ryan, N. Oliver, and D. R. Hinton Connective Tissue Growth Factor as a Mediator of Intraocular Fibrosis Invest. Ophthalmol. Vis. Sci., September 1, 2008; 49(9): 4078 - 4088. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Biswas, Y. Zhao, A. Nagalingam, T. W. Gardner, and L. Sandirasegarane PDGF- and Insulin/IGF-1-Specific Distinct Modes of Class IA PI 3-Kinase Activation in Normal Rat Retinas and RGC-5 Retinal Ganglion Cells Invest. Ophthalmol. Vis. Sci., August 1, 2008; 49(8): 3687 - 3698. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lei, G. Velez, P. Hovland, T. Hirose, and A. Kazlauskas Plasmin Is the Major Protease Responsible for Processing PDGF-C in the Vitreous of Patients with Proliferative Vitreoretinopathy Invest. Ophthalmol. Vis. Sci., January 1, 2008; 49(1): 42 - 48. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Li, A. Maminishkis, F. E. Wang, and S. S. Miller PDGF-C and -D Induced Proliferation/Migration of Human RPE Is Abolished by Inflammatory Cytokines Invest. Ophthalmol. Vis. Sci., December 1, 2007; 48(12): 5722 - 5732. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |