IOVS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2007;48:2719-2725.)
© 2007 by The Association for Research in Vision and Ophthalmology, Inc.
doi:10.1167/iovs.06-0644

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chi, Z.-L.
Right arrow Articles by Hayasaka, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chi, Z.-L.
Right arrow Articles by Hayasaka, Y.

A Cholinergic Agonist Attenuates Endotoxin-Induced Uveitis in Rats

Zai-Long Chi, Seiji Hayasaka, Xue-Yun Zhang, Hu-Shan Cui, and Yoriko Hayasaka

From the Department of Ophthalmology, Graduate School of Medicine, University of Toyama, Toyama, Japan.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. Investigation of physiological anti-inflammatory mechanisms can contribute to the treatment of inflammatory disorders. The purpose of the present study was to investigate the effect of nicotine, a selective cholinergic agonist, on endotoxin-induced uveitis (EIU) in rats and the underlying molecular mechanism.

METHODS. Lipopolysaccharide (LPS; endotoxin) and nicotine were injected intraperitoneally. Clinical scores were evaluated by slit lamp. Intracameral protein content and the number of cells were determined. Immunohistochemical reactivity of {alpha}7 nicotine acetylcholine receptor ({alpha}7nAChR) was examined in the iris and ciliary body (ICB). mRNA and protein levels of cytokines and chemokines were measured by real-time PCR and enzyme-linked immunosorbent assay.

RESULTS. After LPS injection, clinical scores, as well as protein content and number of cells in the aqueous humor increased during 18 to 36 hours. Nicotine inhibited the endotoxin-induced elevation of these levels. mRNA and protein of {alpha}7nAChR expression levels were significantly increased by LPS and/or nicotine injection. Nicotine showed no effects on endotoxin-induced elevation of mRNA levels in ICB. However, nicotine decreased the endotoxin-induced elevation of interleukin (IL)-6, IL-1ß, tumor necrosis factor (TNF)-{alpha}, cytokine-induced neutrophil chemoattractant (CINC)-1, and monocyte chemotactic protein (MCP)-1, but did not affect IL-10 in the serum and aqueous humor.

CONCLUSIONS. Nicotine attenuated endotoxin-induced uveitis through directly decreasing the levels of multiple cytokines and chemokines in the aqueous humor, but did not affect the mRNA levels of these factors. The findings suggest that the nicotinic anti-inflammatory pathway may be involved in the pathogenesis of EIU.


Uveitis frequently leads to severe vision loss and blindness, with disruption of the blood-ocular barrier and neighboring tissues associated with intraocular proliferation. Uveitis is commonly idiopathic, and treatment is difficult. Lipopolysaccharide (LPS, endotoxin)-induced uveitis (EIU) in rats is an animal model of human disease.1 2 Tumor necrosis factor (TNF)-{alpha} and interleukin (IL)-6 have been reported to be involved in the pathogenesis of LPS-induced uveitis.3 4 5 TNF-{alpha}, IL-6, and IL-1ß, which are proinflammatory cytokines, induce uveitis when injected intraocularly in animals.6 IL-8 (CXCL8) and monocyte chemotactic protein (MCP)-1 (CCL2) are members of chemotactic families (chemokines)7 and are present in the plasma of patients with active Behçet’s disease8 and in aqueous humor of patients with active uveitis.9 Rat cytokine-induced neutrophil chemoattractant (CINC)-1 is a counterpart of the human growth-regulated oncogene product and a member of the interleukin-8 family. CINC-1 plays a key role as a mediator of neutrophil infiltration in rats during inflammation.10 11 In various cell types, CINC-1 is produced in response to inflammatory mediators such as TNF-{alpha}, IL-1ß, and LPS.10 11 12 13

Physiological anti-inflammatory mechanisms provide a major advantage to the design of novel pharmacologic strategies against inflammatory diseases. The central nervous system is a pivotal regulator of the immune response and controls inflammation at various levels. Recent studies indicate that stimulation of the vagus nerve can control systemic inflammation in rodents.14 15 16 17 18 19 Accordingly, surgical vagotomy increases the susceptibility of rodents to septic shock,19 suggesting that the vagus nerve can function as a physiological anti-inflammatory system that modulates the immune response. Acetylcholine, the principal neurotransmitter of the vagus nerve, and selective nicotinic agonists can regulate inflammation through a nicotinic anti-inflammatory pathway dependent on the {alpha}7 nicotinic acetylcholine receptor ({alpha}7nAChR).20 Van Dijk et al.21 reported that nicotine inhibits TNF-{alpha} and IL-1ß synthesis in mouse colonic mucosa. Borovikova et al.14 reported that vagus nerve stimulation attenuates the systemic inflammatory response to endotoxin. Wang et al.17 reported that {alpha}7nAChR is an essential regulator of inflammation. We therefore investigated the in vivo effect of nicotine, a selective cholinergic agonist, on EIU in rats.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Six- to eight-week-old Wistar rats (160–180 g) were obtained from Sankyo Labo Service Co. Inc. (Tokyo, Japan). The animals were housed in 12-hour dark and 12-hour light conditions, and were given food and water ad libitum during the experiment. All studies were conducted in compliance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The study was approved by the Institutional Committee for Ethical Animal Care and Treatment.

Injection of LPS and Nicotine
To induce uveitis, 150 µg LPS (Escherichia coli, serotype 055: B5, from Sigma-Aldrich, Inc., St. Louis, MO), in 150 µL of pyrogen-free 0.9% sodium chloride, was injected intraperitoneally. Rats treated with 0.9% sodium chloride served as the control. Nicotine (Sigma-Aldrich, Inc.) was dissolved in 0.9% sodium chloride just before use, and 0.2 to 2 mg/kg of nicotine was injected intraperitoneally at the same time as the LPS was administered. No repeated experiments of LPS injection in the same rats were performed. Multiple samples were used in a single experiment. The experiments were repeated at least twice to ensure reproducibility.

Clinical Evaluation of EIU
Clinical scoring of EIU was performed as described by Behar-Cohen et al.22 The eyes were examined by slit-lamp after LPS injection and nicotine treatment. The severity of EIU was graded from 0 to 4, by a masked investigator, as follows: 0, no inflammatory reaction; 1, discrete dilation of the iris and conjunctival vessels; 2, moderate dilation of the iris and conjunctival vessels with moderate flare in the anterior chamber; 3, intense iridial hyperemia with flare in the anterior chamber; and 4, same clinical signs as 3 plus the presence of fibrinous exudates in the pupillary area and miosis.

Measurement of Intracameral Protein and Number of Cells
Aqueous humor was sampled at 0, 6, 12, 18, 24, 30, and 36 hours after injection of LPS. After intraperitoneal injection of pentobarbital (50 mg/kg body weight), aqueous humor was aspirated with a 30-gauge needle under visualization with a microscope. Aspirated samples were centrifuged at 2500 rpm for 5 minutes at 4°C to obtain the supernatant. Protein concentration in the supernatant was measured by a protein-dye binding assay described by Bradford23 and was expressed as relative values to a bovine serum albumin standard. To 5 µL of aspirated aqueous humor, the same volume of 0.4% trypan blue was added, and then the stained cells were counted with a hemocytometer.

Histopathology
Twenty-four hours after LPS administration, rats were euthanatized. The eyes were enucleated immediately and stored in a mixture of 10% formalin and 2.5% glutaraldehyde for 24 hours. Subsequently, the eyes were embedded in OCT compound. Sagittal sections (6-µm-thick) were cut near the optic nerve head and stained with hematoxylin and eosin.

RNA Extraction and Real-Time Polymerase Chain Reaction
After intraperitoneal injection of pentobarbital (50 mg/kg body weight), the eye globe was enucleated and submerged in RNA stabilization reagent (RNAlater; Qiagen, Hilden, Germany), immediately followed by isolation of the iris-ciliary body tissue from the stabilized eye globe. The dissected iris-ciliary body tissue was homogenized with a rotostater in buffer (RLT; Qiagen). Total RNA was extracted (Rneasy Protect Mini kit, treated with an Rnase-free Dnase Set; Qiagen) to remove any residual genomic DNA. cDNA from each sample was obtained by reverse transcription with random hexamers and multiscribe reverse transcriptase (MultiScribe; Applied Biosystems [ABI], Foster City, CA). Based on the database, real-time PCR primers and probes were designed. Probes and primers are as follows:

For {alpha}7nAChR (GenBank accession no. L31619): forward primer 5'-AGCTGAGTGCAGGTGCTGG-3', reverse primer 5'-CAGGCCTCGGAAGCCAA-3', and TaqMan (ABI) probe 5'-(FAM)CCCACCAGCAATGGCAACCTGC(TAMRA)-3'; for TNF-{alpha} (accession no. NM_012675): forward primer 5'-ACA AGGCTGCCCCGACTAC-3', reverse primer 5'-TCCTGGTATGAAATGGCA AACC-3', and TaqMan probe 5'-(FAM)TGCTCCTCACCCACACCGTCAGC(TAMRA)-3'; for IL-6 (accession no. NM_012509), forward primer 5'- TCAACTCCATCTGCCCTTCAG-3', reverse primer 5'-AAGGCAACTGGCTGGAAGTCT-3', and TaqMan probe 5'-(FAM)AACAGCTATGAAGTTTCTCTCCGCA(TAMRA)-3'; for IL-1ß (accession no. NM_031512), forward primer 5'- AACAGCAATGGTCGGGACATA-3', reverse primer 5'-CATTAGGAATAGTGCAGCCATCTTTA -3', and TaqMan probe 5'-(FAM) TTGACTTCACCATGGAACCCGTGTCTT(TAMRA)-3'; for MCP-1 (accession no. M57441), forward primer 5'-CAGATCTCTCTTCCTCCACCACTAT-3', reverse primer 5'-ACAGGCAGCAACTGTGAACAA-3', and TaqMan probe 5'-(FAM)CAGGTCTCTGTCACGCTTCTGGGCC(TAMRA)-3'; and for glyceraldehyde 3-phosphate dehydrogenase (GAPDH, accession no. AF106860): forward primer 5'-CCGAGGGCCCACTAAAGG-3', reverse primer 5'-GCTGTTGAAGTCACAGGAGACAA-3', and TaqMan probe 5'-(FAM)CATCCTGGGCTACACTGAGGACCA (TAMRA)-3'.

cDNA was used to detect real-time PCR products (TaqMan Universal Master Mix and PRISM 7700 sequence detection system; ABI) with specific primers and probes. The thermal profile for each primer consisted of 2 minutes at 50°C and 10 minutes at 95°C followed by 40 cycles for 15 seconds at 95°C and 1 minute at 60°C. The expression levels of {alpha}7nAChR, IL-6, IL-1ß, TNF-{alpha}, and MCP-1 mRNAs were normalized by the mRNA level of GAPDH in each sample, and the relative changes in expression were shown as an n-fold increase relative to value of rats treated with 0.9% NaCl.

Immunohistochemistry
At 0, 12, 18, 24, 36, and 48 hours after LPS injection, the rat was anesthetized. The blood was washed out with phosphate-buffered saline (PBS), and the animals were perfusion fixed with 4% cold paraformaldehyde in PBS. The eyes were enucleated, cut in half, and fixed with 4% paraformaldehyde in PBS for 20 minutes at 4°C.

Specimens were OCT embedded, frozen, and cryosectioned at a thickness of 10 µm. After they were blocked with 10% normal bovine serum in PBS, the slides were incubated with rabbit anti-rat {alpha}7nAChR antibody (Santa Cruz Biotechnology, Santa Cruz, CA) for 1 hour and immunolabeled with FITC-conjugated bovine anti-rabbit IgG (Santa Cruz Biotechnology) for 30 minutes. Negative control samples were incubated with normal bovine IgG or primary antibody.

Enzyme-Linked-Immunosorbent Assay
After intraperitoneal injection of pentobarbital (50 mg/kg body weight), aqueous humor was aspirated with a 30-gauge needle under microscopic visualization. Aspirated samples were centrifuged at 2500 rpm for 20 minutes at 4°C, to obtain the supernatant. The aqueous humor from both eyes of a rat was diluted up to 30 to 40 µL for the assay. Serum samples were collected and pooled. Protein levels of TNF-{alpha}, IL-6, IL-1ß, IL-10 (Pierce Biotechnology, Inc. Rockford, IL), CINC-1, and MCP-1 (IBL Co., Ltd., Gunma, Japan) were determined by enzyme-linked immunosorbent assay.

Statistics
All data are expressed as the mean ± SD. Statistical analysis was performed using the Scheffé procedure after the ANOVA test for multiple comparison of means. P < 0.05 was considered as statistically significant.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Animal Behavior
No abnormal behavior, including diarrhea and vomiting, was noted in rats treated with LPS or nicotine. No deaths occurred during the experiment.

Clinical scores, Protein Content, and Number of Cells in the Aqueous Humor after Injection of Nicotine and LPS
After LPS injection, clinical scores, protein content, and number of cells in the aqueous humor increased at 6 hours; reached maximum levels (score, 3.8; protein, 12.6 mg/mL; cells, 18.2 x 105/mL) at 24 hours; maintained high level until 36 hours; and decreased at 48 hours (data not shown). However, injection of nicotine (2 mg/kg) improved clinical scores, decreased protein levels in the aqueous humor from 12 to 36 hours (Fig. 1) . Nicotine decreased the elevation of these levels in a dose-dependent manner (Fig. 2) . By intraperitoneal injection of 2 mg/kg nicotine, significant inhibition effects (score, 2.2; protein, 7.3 mg/mL; cells, 6.8 x 105 /mL) were observed (Fig. 2) . Meanwhile, nicotine treatment alone did not affect the scores, the protein content, or the number of cells in the aqueous humor in the rats untreated with LPS. No inflammation was observed histopathologically in rats treated with nicotine alone (Fig. 3B) . However, severe inflammation was found in the anterior and posterior chamber 24 hours after LPS administration (Fig. 3C) . Significant reductions of inflammation were observed in eyes of rats treated with nicotine (2 mg/kg) simultaneously with the LPS injection (Fig. 3D) .


Figure 1
View larger version (18K):
[in this window]
[in a new window]

 
FIGURE 1. Effects of nicotine on LPS-induced uveitis. Clinical scores (A) and protein content in the aqueous humor (B) after injection of nicotine and LPS at each time point are shown. Clinical score evaluation and aqueous sampling were performed at 0, 6, 12, 18, 24, 30, and 36 hours after injection of LPS. Nicotine was injected at the same time as LPS administration. Mean ± SD (n = 4 pairs of eyes). *P < 0.05; **P < 0.01 compared with LPS injection.

 

Figure 2
View larger version (17K):
[in this window]
[in a new window]

 
FIGURE 2. Effects of different doses of nicotine on LPS-induced uveitis. Clinical scores (A), protein content (B), and number of cells (C) in the aqueous humor after injection of nicotine and LPS are shown. Clinical score evaluation and aqueous sampling were performed at 24 hours after injection of LPS. Nicotine was injected at the same time as LPS was administered. Means ± SD (n = 6 pairs of eyes). *P < 0.05; **P < 0.01 compared with LPS injection.

 

Figure 3
View larger version (120K):
[in this window]
[in a new window]

 
FIGURE 3. Histopathology of the anterior segment of the eye at 24 hours after injection of LPS. Rats without LPS injection (A) or with nicotine injection alone (B) showed no inflammation in the anterior and posterior chamber. Severe inflammatory cell infiltration was observed in LPS-injected rats (C). A significant attenuation of inflammation was observed in rats treated with nicotine (2 mg/kg) and LPS simultaneously (D). Results are representative of those in four pairs of eyes. Hematoxylin and eosin; original magnification, x200.

 
Changes in {alpha}7nAChR mRNA and Protein Levels in the Iris and Ciliary Body
{alpha}7nAChR mRNA was expressed in the iris and ciliary body of rats untreated with LPS. The level increased to its maximum at 9 hours after LPS injection (Fig. 4A) . Therefore, we observed the effect of nicotine on {alpha}7nAChR mRNA level at this time point. The result showed that the {alpha}7nAChR mRNA level was elevated by injection of nicotine alone or of both LPS and nicotine (Fig. 4B) .


Figure 4
View larger version (14K):
[in this window]
[in a new window]

 
FIGURE 4. Changes in {alpha}7nAChR mRNA levels in the iris and ciliary body. {alpha}7nAChR mRNA levels at various times after LPS (150 µg) injection are shown (A). The mRNA level reached its maximum at 9 hours after injection of LPS. Therefore, the effect of nicotine (2 mg/kg) on the mRNA level of {alpha}7nAChR in LPS-injected rat was investigated at 9 hours after LPS injection (B). Mean ± SD (n = 6 pairs of eyes). **P < 0.01 compared with the value in rats treated with saline.

 
Immunofluorescent staining for {alpha}7nAChR in the iris and ciliary body was negative after injection of saline (Fig. 5A) . After injection of LPS alone, {alpha}7nAChR proteins were present (Fig. 5B , after 18 hours; Fig. 5C , after 24 hours). Twenty-four hours after injection of nicotine alone, {alpha}7nAChR proteins were observed (Fig. 5D) . After injection of both nicotine and LPS, {alpha}7nAChR proteins increased in the iris and ciliary body (Fig. 5E , after 18 hours; 5F, after 24 hours). The negative control (normal IgG) showed no autofluorescence or nonspecific staining.


Figure 5
View larger version (9K):
[in this window]
[in a new window]

 
FIGURE 5. Immunohistochemistry of {alpha}7nAChR in the iris and ciliary body. Rats without LPS injection (A), 18 hours (B) and 24 hours (C) after LPS injection, treated with nicotine alone (D), and 18 hours (E) and 24 hours (F) after injection of 2 mg/kg nicotine together with LPS. Fluorescein indicates localization of {alpha}7nAChR in the iris and ciliary body. Results are representative of those in four pairs of eyes. Original magnification, x200.

 
Changes in mRNA Levels of Cytokines and Chemokines in the Iris and Ciliary Body
After injection of LPS, mRNAs of IL-6, IL-1ß, TNF-{alpha}, and MCP-1 in the iris and ciliary body increased at 1.5 hours, reached maximum levels at 3 hours, and then gradually decreased (data not shown). Nicotine did not change the elevated levels of IL-6 mRNA (Fig. 6A) , IL-1ß mRNA (Fig. 6B) , TNF-{alpha} mRNA (Fig. 6C) , and MCP-1 mRNA (Fig. 6D) at 3 hours after injection of LPS.


Figure 6
View larger version (16K):
[in this window]
[in a new window]

 
FIGURE 6. Changes in mRNA levels of cytokines and chemokines in the iris and ciliary body. The globes were enucleated 3 hours after injection of saline, nicotine, and/or LPS. Levels of IL-6 mRNA (A), IL-1ß mRNA (B), TNF-{alpha} mRNA (C), and MCP-1 mRNA (D) were measured in the tissues. Mean ± SD (n = 6 pairs of eyes).

 
Changes in Cytokines and Chemokines in the Serum and Aqueous Humor
High levels of IL-6, CINC-1, MCP-1, and IL-10 were detected in the serum at 24 hours after LPS administration. Treatment with 2 mg/kg of nicotine significantly reduced the levels of serum IL-6, CINC-1, and MCP-1, but did not suppress release of the anti-inflammatory cytokine IL-10 (Fig. 7) . After LPS injection, TNF-{alpha} and IL-1ß serum levels were below the detection sensitivities of the assays in rats (Fig. 7) . All the cytokines and chemokines tested were below detection levels in control rats injected with saline or nicotine alone.


Figure 7
View larger version (8K):
[in this window]
[in a new window]

 
FIGURE 7. Cytokines and chemokines in serum. Levels of IL-6, TNF-{alpha}, IL-1ß, CINC-1, MCP-1, and IL-10 in pooled serum obtained from LPS injection ({blacksquare}) and both nicotine (2 mg/kg) and LPS injection ({square}) of rats at 24 hours. Mean ± SD (n = 4 pairs of eyes). *P < 0.05; **P < 0.01 compared with the LPS-treated group.

 
After injection of LPS, IL-6, IL-1ß, TNF-{alpha}, CINC-1, MCP-1, and IL-10 reached maximum levels at 24 hours in the aqueous humor. Nicotine (1–2 mg/kg) decreased the elevated levels of proinflammatory cytokines and chemokines in the aqueous humor 24 hours after LPS administration in a dose-dependent manner, but failed to prevent the constitutive release of the anti-inflammatory cytokine IL-10 (Fig. 8) .


Figure 8
View larger version (21K):
[in this window]
[in a new window]

 
FIGURE 8. Cytokines and chemokines in aqueous humor. Aqueous samples were aspirated at 24 hours after injection of saline, nicotine, and/or LPS. Expression levels of IL-6 (A), IL-1ß (B), TNF-{alpha} (C), CINC-1 (D), MCP-1 (E), and IL-10 (F) are shown. Mean ± SD (n = 12 pairs of eyes). *P < 0.05; **P < 0.01 compared with the LPS-treated group.

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Physiological anti-inflammatory mechanisms represent efficient systems that have been selected by evolution to control inflammation. These mechanisms may provide advantages that can be exploited for the treatment of inflammatory disorders. Previous studies have shown that nicotine, a more selective cholinergic agonist, prevents endotoxin-induced TNF-{alpha} production in macrophage cultures and microvascular endothelial cells.14 17 18 24 It is still unclear whether this pharmacological strategy can be applied in vivo to improve EIU. In the current study, nicotine improved clinical scores and decreased protein content and the number of cells in rats with EIU (Figs. 1 2 3) . The LD50 (median lethal dose) of nicotine in mice was reported to be 3 to 9 mg/kg.24 In the present study, we used intraperitoneal injection of nicotine (0.2–2 mg/kg), and the effective doses (1–2 mg/kg) were similar to those described by Saeed et al.,24 in which nicotine (2 mg/kg) inhibits endothelial cell adhesion molecule expression in mice.

To examine whether the {alpha}7nAChR is essential for the cholinergic anti-inflammatory pathway in vivo, Wang et al.17 measured TNF-{alpha} production in {alpha}7nAChR-deficient mice. The serum TNF-{alpha} level in {alpha}7nAChR-deficient mice after administration of endotoxin was significantly higher than that in wild-type endotoxemic mice, indicating a critical function of the {alpha}7nAChR in the normal regulation of systemic inflammatory responses in vivo. {alpha}7nAChR is expressed in macrophages17 20 24 and endothelial cells.15 25 26 27 {alpha}7nAChR mRNA and protein in the iris and ciliary body (Figs 4 5) in the present study may exist in inflammatory cells and vascular endothelial cells in the tissues. Nicotine alone or both nicotine and LPS injection elevated the expression of {alpha}7nAChR in the iris and ciliary body. Nicotine inhibited LPS-induced elevation of serum IL-6, CINC-1, and MCP-1 (Fig. 7) . It reduced the LPS-induced release of proinflammatory cytokines and chemokines, such as IL-6, TNF-{alpha}, IL-1ß, CINC-1, and MCP-1, but not anti-inflammatory cytokine IL-10 in a dose-dependent way in the aqueous humor (Fig. 8) . It is possible that nicotinic anti-inflammatory pathways are involved in the pathogenesis of EIU in rats.

Nicotine inhibited the expression of cytokines and chemokines in aqueous humor, but did not influence the mRNA levels of these cytokines and chemokines (Fig. 6) , indicating that activation of the cholinergic receptor transduces intracellular signals that inhibit synthesis of cytokines and chemokines at a posttranscriptional stage, as stated by Tracey18 and Ulloa.20 Also, Wang et al.15 have reported that nicotine may affect macrophage activation by modulating HMGB1 acetylation or phosphorylation as a posttranslational regulation.

The NF-{kappa}B pathway is crucial for macrophage activation and the production of proinflammatory cytokines.28 In an earlier study,5 we reported that NF-{kappa}B translocation is involved in the pathogenesis of LPS-induced uveitis. Wang et al.15 and Saeed et al.24 reported that nicotine suppresses the production of proinflammatory cytokines from macrophages and microvascular endothelial cells by inhibiting the NF-{kappa}B pathway through an {alpha}7nAChR-dependent anti-inflammatory pathway. Because {alpha}7nAChR can control the NF-{kappa}B pathway, a pharmacological target for several inflammatory disorders, nicotine and selective nicotinic agonists could provide a therapeutic potential target for the treatment of a variety of inflammatory disorders. The clinical therapeutic use of nicotine has been suggested for the treatment of a large number of human diseases, including depression, Parkinson’s disease, and inflammatory disorders such as Crohn’s disease and ulcerative colitis.29 30 31

Our results indicate that cholinergic agonists suppress cytokine and chemokine release through a novel nicotinic anti-inflammatory pathway depending on {alpha}7nAChR. These results support {alpha}7nAChR as a potential pharmacological target for EIU and systemic inflammation, and further investigation is warranted to determine its potentially clinical translation.


    Footnotes
 
Supported in part by Grant-in-Aid for Scientific Research 14571661 and by the 21st century COE (Centers of Excellence) program of the Ministry of Education, Science, Sports and Culture of Japan.

Submitted for publication June 13, 2006; revised October 5 and 30, 2006; accepted April 19, 2007.

Disclosure: Z.-L. Chi, None; S. Hayasaka, None; X.-Y. Zhang, None; H.-S. Cui, None; Y. Hayasaka, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Zai-Long Chi, Department of Ophthalmology, Graduate School of Medicine, University of Toyama, 2630 Sugitani, Toyama 930-0194, Japan; ophthal{at}med.u-toyama.ac.jp.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Rosenbaum JT, McDevitt HO, Guss RB, Egbert PR. Endotoxin-induced uveitis in rats as a model for human disease. Nature. 1980;286:611–613.[CrossRef][Medline][Order article via Infotrieve]
  2. Bhattacherjee P, Williams RN, Eakins KE. An evaluation of ocular inflammation following the injection of bacterial endotoxin into the rat foot pad. Invest Ophthalmol Vis Sci. 1983;24:196–202.[Free Full Text]
  3. Hoekzema R, Verhagen C, van Haren M, Kijlstra A. Endotoxin-induced uveitis in the rat: significance of intraocular interleukin-6. Invest Ophthalmol Vis Sci. 1982;33:532–539.
  4. de Vos AF, van Haren MA, Verhagen C, Hoekzema R, Kijlstra A. Kinetics of intraocular tumor necrosis factor and interleukin-6 in endotoxin-induced uveitis in the rat. Invest Ophthalmol Vis Sci. 1994;35:1100–1106.[Abstract/Free Full Text]
  5. Chi ZL, Hayasaka S, Zhang XY, Hayasaka Y, Cui HS. Effects of rolipram, a selective inhibitor of type 4 phosphodiesterase, on lipopolysaccharide-induced uveitis in rats. Invest Ophthalmol Vis Sci. 2004;45:2497–2502.[Abstract/Free Full Text]
  6. de Vos AF, Hoekzema R, Kijlstra A. Cytokines and uveitis. Curr Eye Res. 1992;6:581–597.
  7. Zlotnik A, Yoshie O. A new classification system and their role in immunity. Immunity. 2000;12:121–127.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  8. Kaburaki T, Fujino Y, Kawashima H, et al. Plasma and whole-blood chemokine levels in patients with Behçet’s disease. Graefes Arch Clin Exp Ophthalmol. 2003;241:353–358.[Web of Science][Medline][Order article via Infotrieve]
  9. Verma MJ, Lloyd A, Roger H, et al. Chemokines in acute anterior uveitis. Curr Eye Res. 1997;16:1202–1208.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  10. Watanabe K, Kinoshita S, Nakagawa H. Purification and characterization of cytokine-induced neutrophil chemoattractant produced by epithelioid cell line of normal rat kidney (NRK-52E cell). Biochem Biophys Res Commun. 1989;161:1093–1099.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  11. Handa O, Naito Y, Takagi T, et al. Tumor necrosis factor-{alpha}-induced cytokine- induced neutrophil chemoattractant-1 (CINC-1) production by rat gastric epithelial cells: role of reactive oxygen species and nuclear factor-kB. J Pharmacol Exp Ther. 2004;309:670–676.[Abstract/Free Full Text]
  12. Seino Y, Ikeda U, Minezaki KK, et al. Expression of cytokine-induced neutrophil chemoattractant in rat cardiac myocytes. J Mol Cell Cardiol. 1995;27:2043–2051.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  13. Yoshida H, Miura S, Kishikawa H, et al. Fatty acids enhance GRO/CINC-1 and interleukin-6 production in rat intestinal epithelial cells. J Nutr. 2001;131:2943–2950.[Abstract/Free Full Text]
  14. Borovikova LV, Ivanova S, Zhang M, et al. Vagus nerve stimulation attenuates the systemic inflammatory response to endotoxin. Nature. 2000;405:458–462.[CrossRef][Medline][Order article via Infotrieve]
  15. Wang H, Liao H, Ochani M, et al. Cholinergic agonists inhibit HMGB1 release and improve survival in experimental sepsis. Nat Med. 2004;10:1216–1221.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  16. Matthay MA, Ware LB. Can nicotine treat sepsis?. Nat Med. 2004;10:1161–1162.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  17. Wang H, Yu M, Ochani M, et al. Nicotinic acetylcholine receptor {alpha}7 subunit is an essential regulator of inflammation. Nature. 2003;421:384–388.[CrossRef][Medline][Order article via Infotrieve]
  18. Tracey KJ. The inflammatory reflex. Nature. 2002;420:853–859.[CrossRef][Medline][Order article via Infotrieve]
  19. Bernik TR, Friedman SG, Ochani M, et al. Pharmacological stimulation of the cholinergic anti-inflammatory pathway. J Exp Med. 2002;195:781–788.[Abstract/Free Full Text]
  20. Ulloa L. The vagus nerve and the nicotinic anti-inflammatory pathway. Nat Rev Drug Discov. 2005;4:673–684.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  21. Van Dijk JPM, Madretsma GS, Keuskamp ZJ, Zijlstra FJ. Nicotine inhibits cytokine synthesis by mouse colonic mucosa. Eur J Pharmacol. 1995;278:R11–R12.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  22. Behar-Cohen FF, Savoldelli M, Parel JM, et al. Regulation of corneal edema in endotoxin-induced uveitis after application of L-NAME and nitric oxide synthase inhibitor in rats by iontophoresis. Invest Ophthalmol Vis Sci. 1998;39:897–904.[Abstract/Free Full Text]
  23. Bradford MM. A rapid and sensitive method for quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  24. Saeed RW, Varma S, Peng-Nemeroff T, et al. Cholinergic stimulation blocks endothelial cell activation and leukocyte recruitment during inflammation. J Exp Med. 2005;201:1113–1123.[Abstract/Free Full Text]
  25. Macklin KD, Maus AD, Pereira EFR, Albuquerque EX, Conti-Fine BM. Human vascular endothelial cells express functional nicotinic acetylcholine receptors. J Pharmacol Exp Ther. 1998;287:435–439.[Abstract/Free Full Text]
  26. Wang Y, Pereira EFR, Maus ADJ, et al. Human bronchial epithelial and endothelial cells express {alpha}7 nicotinic acetylcholine receptors. Mol Pharmacol. 2001;60:1201–1209.[Abstract/Free Full Text]
  27. Abbruscato TJ, Lopez SP, Mark KS, Hawkins BT, Davis TP. Nicotine and cotinine modulate cerebral microvascular permeability and protein expression of ZO-1 through nicotinic acetylcholine receptors expressed on brain endothelial cells. J Pharmacol Sci. 2002;91:2525–2538.[CrossRef]
  28. Baeuerle PA, Henkel T. Function and activation of NF-kB in the immune system. Annu Rev Immunol. 1994;12:141–179.[Web of Science][Medline][Order article via Infotrieve]
  29. Mandavilli A. Nicotine fix. Nat Med. 2004;10:660–661.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  30. Libert C. Inflammation: a nervous connection. Nature. 2003;421:328–329.[CrossRef][Medline][Order article via Infotrieve]
  31. Pullan RD, Rhodes J, Ganesh S, et al. Transdermal nicotine for active ulcerative colitis. N Engl J Med. 1994;330:811–815.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
IOVSHome page
D. V. Pereira, A. V. Steckert, F. Mina, F. Petronilho, R. Roesler, G. Schwartsmann, C. Ritter, and F. Dal-Pizzol
Effects of an Antagonist of the Gastrin-Releasing Peptide Receptor in an Animal Model of Uveitis
Invest. Ophthalmol. Vis. Sci., November 1, 2009; 50(11): 5300 - 5303.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
I. A. J. Giebelen, M. Leendertse, S. Florquin, and T. van der Poll
Stimulation of acetylcholine receptors impairs host defence during pneumococcal pneumonia
Eur. Respir. J., February 1, 2009; 33(2): 375 - 381.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chi, Z.-L.
Right arrow Articles by Hayasaka, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chi, Z.-L.
Right arrow Articles by Hayasaka, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS