IOVS Molecular and Cellular Biology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2007;48:3490-3505.)
© 2007 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.07-0016

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gaudreault, M.
Right arrow Articles by Guérin, S. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gaudreault, M.
Right arrow Articles by Guérin, S. L.

Laminin Reduces Expression of the Human {alpha}6 Integrin Subunit Gene by Altering the Level of the Transcription Factors Sp1 and Sp3

Manon Gaudreault,1 François Vigneault,1 Steeve Leclerc,1 and Sylvain L. Guérin1,2

1From the Oncology and Molecular Endocrinology Research Center and the 2Unit of Ophthalmology, CHUL, Centre Hospitalier Universitaire de Québec and Laval University, Québec, QC, Canada.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. Damage to the corneal epithelium results in the massive secretion of fibronectin (FN) shortly after corneal injury, which is later replaced by the secretion of laminin (LM). Laminin is recognized by receptors ({alpha}6ß1 and {alpha}6ß4) that belong to the integrin family. The authors characterized the regulatory influence exerted by laminin on the Sp1/Sp3-mediated {alpha}6 gene promoter function.

METHODS. Recombinant plasmids bearing the CAT reporter gene, fused to various segments from the {alpha}6 promoter, were transfected into rabbit corneal epithelial cells (RCECs) grown on untreated or on LM-coated culture plates or into Sp1-deficient Drosophila Schneider cells. Expression and DNA binding of Sp1/Sp3 was monitored with the use of Western blot and electrophoretic mobility shift assays (EMSAs), respectively. DNA target sites for Sp1/Sp3 in the {alpha}6 gene promoter were identified in vitro by DNAse I footprinting. Binding of Sp1 and of a few other transcription factors was also examined in vivo by chromatin immunoprecipitation (ChIP) assays. Expression of the {alpha}6 mRNA in RCECs grown on LM-coated culture plates was also assessed by Northern blot and RT-PCR analyses.

RESULTS. Transfection experiments provided evidence that both Sp1 and Sp3 positively influence {alpha}6 promoter activity in Sp1/Sp3-deficient SL2 Schneider cells. Two GC-rich target sites for Sp1/Sp3 (a proximal and a distal site) were identified in the {alpha}6 promoter by DNAse I footprinting. Binding of Sp1/Sp3 was further validated in vivo by ChIP. Transfections conducted into RCECs grown on LM-coated culture plates resulted in repression of the activity directed by the {alpha}6 promoter. This LM-mediated negative regulatory influence also translated into a similar reduction in the expression of the endogenous {alpha}6 mRNA as revealed by both RT-PCR and Northern blot analyses. Most of all, results from EMSA and Western blot analyses suggested that the LM-mediated repression of the {alpha}6 promoter activity results in part from the proteolytic cleavage of Sp1/Sp3.

CONCLUSIONS. Unlike FN, which functions as an activator of {alpha}5 gene transcription, LM repressed transcription, directed by the {alpha}6 gene promoter, by altering the nuclear levels of Sp1 and Sp3. Reappearance of LM in the basement membrane after repair of the corneal damage is therefore expected to substantially contribute to the final steps of this process by influencing the degree to which genes that encode protein products requested for cell adhesion and migration, such as integrin genes, are expressed during corneal wound healing.


The corneal epithelium is made up of five to seven layers of regularly arranged squamous epithelial cells. On corneal injury, the damaged cells should be replaced rapidly to maintain proper visual acuity, a process that is ensured by the centripetal migration of stem cell-derived transient amplifying cells from the corneal limbus.1 2 The early events of the wounding process are chiefly characterized by the disassembling of the hemidesmosomes in the epithelial cells 50 to 70 µm from the wound edge3 and the massive secretion of fibronectin (FN), which peaks as late as 3 to 12 hours after corneal damage and whose expression is transitory in the basal membrane as it starts disappearing 1 week later.4 5 It is thought that the newly synthesized FN serves as a temporary matrix for the attachment and migration of the basal epithelial cells that border the injured area.6 It is produced by subepithelial stromal cells in superficial wounds that alter the epithelium or by stromal cells and corneal epithelial cells in more important wounds that also involve the basal membrane and the stroma.7 As FN staining progressively diminishes, the secretion of laminin (LM), a major component of the basal membrane (BM), increases to reach maximal expression 1 week after corneal damage.4 LM-1 (recently reclassified as LM-1118 ), LM-5 (recently reclassified as LM-3328 ), and LM-10 (recently reclassified as LM-5118 ) are the major LM isoforms in the corneal BM.9 10 The primary function of FN and LM is in cell-matrix attachment, but many additional biological activities, including the promotion of cell migration, wound repair, and mediated cell-signaling events, have been demonstrated.9 11 The BM has many functions that help maintain the normal multilayer structure in the corneal epithelium. Interaction of its basic components, collagen and LM, with their corresponding transmembrane integrin receptors, control cell shape, gene expression, cell migration and proliferation, and programmed cell death.

Integrins are widely expressed, glycosylated, heterodimeric transmembrane adhesion receptors made up of noncovalently bound {alpha}- and ß-subunits that link the extracellular matrix (ECM) to the cell’s cytoskeleton. They mediate bidirectional transfer of information through diverse signal transduction pathways (for reviews, see Plow et al.12 and van der Flier and Sonnenberg13 ). In a recent survey of the human genome, 24 {alpha}- and 9 ß-integrin subunits have been identified,14 which implies 6 novel {alpha}- and 1 novel ß-subunits relative to the previously recognized 18 {alpha}- and 8 ß-subunits reported to form 24 different heterodimers.12 15 16 17 However, the existence of these new integrin subunits remains to be firmly established. The {alpha}6ß1 and the {alpha}6ß4 integrins recognize LM as their ligand.18 19 The integrin {alpha}6ß4 is a component of the hemidesmosomes (HDs) and is therefore located to the basal side of the basal epithelial cells.20 21 22 23 HDs are specialized junctional complexes that contribute to the attachment of epithelial cells to the BM24 and are implicated in signal transduction through {alpha}6ß4.25 The pattern of integrins expressed by the basal cells of the corneal epithelium is considerably altered as the leading edge progresses toward the wounded corneal surface.4 20 26 27 A few studies reported dynamic changes in the distribution of the {alpha}6 subunit during corneal wound healing in vivo.20 28 In response to wounding, HDs are disassembled, and the expression of {alpha}622 and ß427 increases during migration of the epithelial cells in vivo. Stepp et al.27 suggested that the increased ß4 expression must play a role in cell-cell or cell-substrate adhesion mechanisms that are required during the corneal wounding or in the preparation of cells for the restratification process.

Although FN deposition can be observed as early as 3 hours after damage to the corneal epithelium, no staining of LM occurs beneath the leading edge of migrating epithelial cells until 24 hours after the injury.29 Interestingly, FN has been shown to influence the transcriptional activity not only of the {alpha}5 subunit gene30 but also that of the LM binding {alpha}6 integrin subunit 22 in in vitro cultures of rabbit corneal epithelial cells (RCECs). These results suggest that while corneal epithelial cells start migrating over the newly synthesized temporary FN matrix, expression of the {alpha}5 and {alpha}6 integrin subunit genes is turned on, ensuring early expression of the {alpha}6 subunit well before LM accumulates beneath the leading edge. As a consequence, the signal transduction pathway activated on binding of the {alpha}6ß1 and {alpha}6ß4 integrins to their ligand LM might trigger regulatory signals distinct from those resulting from the binding of FN to the {alpha}5ß1 integrin. Activation of the MAPK pathway through the binding of FN to its {alpha}5ß1 integrin was recently reported to result in the transcriptional activation of the {alpha}5 gene through a modification in the phosphorylation state of Sp1.30 Both the promoter and the 5'-flanking region of the human {alpha}6 subunit gene have recently been cloned.31 32 33 Although multiple target sites for Sp1 were identified along the {alpha}6 proximal promoter sequence by DNAse I footprinting,32 only the most proximal Sp1 site (position –48 to –43) was assessed for its regulatory influence through site-directed mutagenesis.31 In addition, all {alpha}6 promoter transfection experiments conducted to date were performed in cancer cell lines of various origins. Nontransformed primary cultured cells are much closer to their in vivo counterparts than are transformed cells or cell lines; consequently, they are attractive as a source of cellular material for gene expression studies34 35 36 (also see Gaudreault et al.37 ). Considering that cancer cell lines and nontransformed primary cultured cells of similar tissue origin often behave differently, regulatory elements with negligible regulatory influence in transformed cells may be required for gene transcription in nontransformed cells.

The purpose of this study was to investigate in more detail the role exerted by the positive transcription factors Sp1 and Sp3 on the transcriptional activity directed by the {alpha}6 promoter in primary cultured and established tissue-cultured cells and to evaluate whether LM may alter the regulatory influence mediated by these nuclear proteins. DNAse I footprinting analyses identified two specific target sites for Sp1 (a proximal and a distal site) along the {alpha}6 promoter sequence. Binding of Sp1 to the {alpha}6 promoter was also demonstrated in vivo through ChIP assays. Site-directed mutational analyses provided evidence that different cells use either Sp1 target site, proximal or distal, with varying efficiency. Most of all, the activity directed by the {alpha}6 promoter was found to be downregulated when RCECs were grown on LM-coated culture plates. The reduced {alpha}6 promoter activity was shown to rely, at least in part, on a reduced level of expression of Sp1 and Sp3 in corneal epithelial cells (RCECs and HCECs) when they are grown on LM.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
All experiments were conducted in voluntary compliance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research, and all procedures were approved by the Laval University Animal Care and Use Committee.

Cell Culture and Media
HCECs were isolated from the limbal area of normal eyes from a 44-year-old donor and were obtained through the Eye Bank from the CHUL Research Center in accordance with a procedure we previously described.37 38 RCECs were obtained from the central area of freshly dissected rabbit corneas and were grown into SHEM medium (fetal bovine serum, 15% wt/vol), as recently described.39 Human skin keratinocytes (HSKs) were obtained from normal newborn foreskin specimens from a 17-day-old donor and were cultured with a feeder layer, as recently described.40 Human skin fibroblasts (HSFs) were isolated from skin biopsy specimens of healthy male donors and underwent primary culture in Dulbecco modified Eagle medium (DMEM, Gibco BRL, Burlington, ON, Canada) supplemented with 10% fetal bovine serum (FBS; Gibco BRL). Human epithelioid carcinoma HeLa (ATCC CCL 2) cells were grown in DMEM supplemented with 10% fetal bovine serum (FBS). Human colon adenocarcinoma Caco2/15, a derivative of the Caco2 cell line (ATCC HTB-37; Rockville, MD) characterized by Beaulieu and Quaroni,41 was grown in DMEM high glucose, 10% FBS, HEPES 20 mM, and glutamine 10 mM. ARPE-19 cells were purchased from the ATCC (CRL-2302) (Manassas, VA) and grown in DMEM/F12 growth medium (Canadian Life Technologies, Burlington, ON, Canada) with 3 mM glutamine (Sigma, Oakville, ON, Canada) and supplemented with 10% fetal bovine serum (Hyclone, Logan, UT). SL2 Drosophila Schneider cells (ATCC CRL-1963) were cultured at 28°C without CO2 in Schneider insect medium (Sigma) supplemented with 10% FBS and 20 µg/mL gentamicin. All cells were grown under 5% CO2 at 37°C, and gentamicin was added to all media at a final concentration of 15 µg/mL.

Flow Cytometric Analysis
RCECs, HeLa, HSFs, HSKs, and ARPE-19 cells were grown as described and removed from the culture dishes (Sarstedt, Montréal, QC, Canada) with PBS/citrate/EDTA solution and were washed twice with serum-free medium containing 1% BSA and fixed with 1% paraformaldehyde-PBS (1% PFA/PBS) for 20 minutes. Aliquots of fixed cells (1 x 106) were washed twice and resuspended in PBS (pH 7.2) containing 1% BSA. One microgram of a primary antibody directed against the {alpha}6 integrin subunit (MA6; Chemicon, Temecula, CA) was added to cell suspensions for 60 minutes at room temperature and agitated on a rotator. After 1 hour, cells were washed twice, and a dilution of 1:100 of fluorescein isothiocyanate-conjugated (FITC) human anti-rat IgG suspended in PBS-1% BSA was added to cells and incubated for 30 minutes on a rotator at room temperature. Finally, cells were resuspended in 1% PFA/PBS and analyzed with a flow cytometer (Epics XL; Beckman Coulter, Miami, FL).

Laminin and Fibronectin Coating
Skin keratinocytes (2.5 x 104/cm2) known for their ability to secrete large amounts of LM-542 and obtained from an adult skin donor (kindly provided by Lucie Germain, Laboratoire d’Organogénèse Expérimentale [LOEX], Hôpital du Saint-Sacrement du CHA, Québec, QC, Canada) were plated on an irradiated 3T3 feeder layer (2 x 104 3T3/cm2) on tissue culture plates. Keratinocytes were cultured in Dulbecco-Vogt modified Eagle medium (Life Technologies, Grand Island, NY), supplemented with 10% fetal calf serum (FCS; Hyclone-PDI Bioscience, Aurora, ON, Canada), 100 IU/mL penicillin, and 25 µg/mL gentamicin (Sigma, St. Louis, MO) until they reached 30%, 70%, or 100% cell density for various periods of time (1, 3, 5, and 10 days) and then were completely removed from the plates by incubation in 20 mM NH4OH for 5 to 10 minutes. The plates on which LM was deposited were then washed with PBS and reseeded either with RCECs (2.5 x 104/cm2) or HCECs (5 x 104/cm2) grown to midconfluence before transfection. A similar approach was used with Caco2/15 cells, which are known for their ability to secrete LM-1043 and LM-1. 44 When indicated, coating of tissue-culture plates with commercially purified LM (LM-1, 0.5–8 µg/cm2; Sigma) before RCECs were added, as described.30 Human plasma FN (obtained as previously described45 ) was coated for 18 hours at 37°C on the culture dishes at 8 µg/cm2. Coated petri dishes were washed twice with PBS and blocked at 37°C with 2% BSA in PBS. Cells were then seeded and grown as described.

Plasmids and Oligonucleotides
Recombinant plasmids {alpha}6–84, {alpha}6–141, {alpha}6–181, {alpha}6–352, {alpha}6–430, and {alpha}6–590—all of which bore the chloramphenicol acetyltransferase (CAT) reporter gene fused to DNA fragments from the human {alpha}6 gene upstream regulatory sequence extending to 5' positions –84, –141, –181, –352, –430, and –590 but shared a common 3' end located at position +76—were constructed. The PGEM-3Z f(+) AvaI/{alpha}6 plasmid that bears the human {alpha}6 gene promoter from position –930 to +76 relative to the {alpha}6 mRNA start site (generously provided by Schei Kitazawa, Kobe University School of Medicine, Kusunoki-Cho, Chuo-Ku, Kobe, Japan) was linearized at its unique KpnI site (5' end) and was treated with the nuclease Bal31 before it was blunted. The 5'-digested {alpha}6 promoter fragments generated were then digested with HindIII (3' end at {alpha}6 position +76) before they were ligated into the unique SmaI/HindIII sites of the plasmid PGL3 to produce the PGL3/{alpha}6–590 vector. The PGL3/{alpha}6–590 construct was digested with NheI and blunt-ended with Klenow (which then preserved the {alpha}6–590 5' end), before it was second-digested with XbaI (which preserved the {alpha}6 +76 3' end). The resultant {alpha}6 promoter-bearing DNA fragment was ligated upstream of the CAT reporter gene from the pCATBasic vector (Promega, Madison, WI), which was first digested with PstI (5' end), blunt-ended with Klenow, and second digested with XbaI (3' end) before its dephosphorylation with alkaline phosphatase (to yield pCATBasic/{alpha}6–590). Removal of the {alpha}6 promoter fragments from the common SphI site (located upstream from {alpha}6 promoter position –590 in the multiple cloning site of the parental plasmid pCATBasic) to the internal restriction sites SacII (at {alpha}6 position –84), KpnI (at –141), SacI (at –181), NsiI (at –352), and AccI (at position –430) yielded, after blunt-ending with Klenow and ligation, the plasmids {alpha}6–84, {alpha}6–141, {alpha}6–181, {alpha}6–352, and {alpha}6–430, respectively.

The plasmid derivatives {alpha}6–84/mSp1p, {alpha}6–141/mSp1p, and {alpha}6–352/mSp1p (which bear mutations into the proximal Sp1 site), {alpha}6–352/mSp1d (which bear mutations into the distal Sp1 site), and {alpha}6–352/mSp1pd (which bear mutations into the proximal and the distal Sp1 sites) were all produced by PCR with a site-directed mutagenesis kit (QuickChange; Stratagene, La Jolla, CA) according to the manufacturer’s instructions. Parental plasmids {alpha}6–84, {alpha}6–141, and {alpha}6–352 were used as templates. Double-stranded oligonucleotides used to introduce mutations in the Sp1 sites (mutations are shown in bold) contained the following sequences: proximal Sp1 site (top strand, 5'-GGGGCGAGAGGGTGGGGAGGATCGCGGCCGGCGTCCTCGTC-3'; bottom strand, 5'-GACGAGGACGCCGGCCGCGATCCTCCCCACCCTCTCGCCCC-3'); distal Sp1 site (top strand, 5'-GTCCACAGAGATCGCCGCAGTGGGGCTGCTTCGCCG-3'; bottom strand, 5'-CGGCGAAGCAGCCCCACTGCGGCGATCTCTGTGGAC-3'). Sp1 and Sp3 expression plasmids pPacSp1 and pPacSp3, respectively, were obtained from Guntram Suske (Institute für Molecularbiology und Tumorforschung, Philipps Universität, Marburg, Germany). Double-stranded oligonucleotides used for competition assays in the EMSAs contained the following DNA sequences: proximal (5'-GAGGGTGGGGAGGGGCGGGGCCGGCGTCCTCGTCA-3') and distal (5'-TTCTGTCCACAGAGGGCGGCGCAGTGGGGCTGCTT-3'); Sp1 sites identified in this study in the {alpha}6 gene promoter and in the alternative Sp1pa site (5'-GGGCGCGCAAGGAGGGGCGAGAGGGTGGGGAGGGG-3'); the high-affinity binding sites for the transcription factors Sp1 (5'-GATCATATCTGCGGGGCGGGGCAGACACAG-3')46 and NFI (5'-TTATTTTGGATTGAAGCCAATATGAG-3')47 ; the consensus sequence for the transcription factor E2F1 (5'-CAGAGCCGTTTCGCGCGGTGCGGGCGGTGC-3'); and the AP-1 site identified in the promoter of the human {alpha}5 integrin subunit gene (5'-GATCCCCGCGTTGAGTCATTCGCCTC-3').48 All oligonucleotides used in the present study were chemically synthesized (Biosearch 8700 apparatus; Millipore, Beford, MA).

DNAse I Footprinting
DNAse I footprinting was performed in DNAse I buffer49 by incubating 3 x 104 cpm labeled probe with increasing amounts (1–10 µL) of recombinant Sp1 protein (GST-Sp1–8xHis protein; kindly provided by Claude Labrie, Oncology and Molecular Endocrinology Research Center, CHUL). The recombinant GST-Sp1–8xHis protein was overexpressed in Escherichia coli BL21 CodonPlus R1L cells with the pGEX-Sp1–8xHis plasmid before purification, as described.50 The 217-bp HindIII-XbaI DNA fragment from the {alpha}6 promoter extending from positions –141 to +76 and the 430-bp fragment spanning {alpha}6 promoter sequences from –352 to +76 were used as labeled probes in these assays. DNAse I digestion and further analysis of the digestion products onto polyacrylamide sequencing gels were performed as described.49

Chromatin Immunoprecipitation Assays
ChIP analyses were conducted as previously described.51 Briefly, HCECs were grown on 150-mm tissue culture dishes to approximately 75% confluence in complete medium. Cells were then cross-linked with 1% formaldehyde for 10 minutes, harvested, and chromatin immunoprecipitated with 1 µg polyclonal antibodies directed against the Sp1 (sc-59; Santa Cruz Biotechnology, Inc., Santa Cruz, CA), Sp3 (sc-644; Santa Cruz Biotechnology), and NFI (SC-5567; Santa Cruz Biotechnology) and E2F1 (sc-193x; Santa Cruz Biotechnology) transcription factors. The resultant DNA was analyzed by PCR using a pair of primers (ITGA6-U,5'CTATCAAGGTGTGCGCTGTG-3'; ITGA6-L,5'CAGAATTGTGGTTGCCGAGTA-3') spanning the entire ITGA6 gene-promoter area. As a negative control, each ChIP sample was also subjected to PCR using primers (p21-U [5'AATTCCTCTGAAAGCTGACTGCC3'] and p21-L [5'OAGGTTTACCTGGGGTCTTTA-GA-3']) specific to a region located approximately 2 kbp upstream of the human p21 promoter. Standard deviation is provided and has been calculated from three separate experiments.

Transient Transfections and CAT Assays
HCECs and RCECs were grown to midconfluence (near 80% coverage) into six-well (35-mm) tissue culture plates and transiently transfected using a polycationic detergent reagent (Lipofectamine; Gibco BRL) according to a procedure we previously described.30 52 Each reagent (Lipofectamine)-transfected plate received 1 µg {alpha}6-CAT test plasmid and 0.5 µg human growth hormone (hGH)-encoding plasmid pXGH5.53 Primary cultured HSFs, established tissue culture HeLa cells, and Drosophila SL2 Schneider cells were transfected according to the calcium phosphate precipitation procedure49 54 at a density of 5 x 105 HSF, 4 x 105 HeLa, or 1 x 106 SL2 cells per 60-mm culture plate. Levels of CAT activity for all transfected cells were determined as described54 and were normalized to either ß-galactosidase or the amount of hGH secreted into the culture media and were assayed using a kit for quantitative measurement of hGH (Immunocorp, Montréal, QC, Canada). The value presented for each individual test plasmid transfected corresponded to the mean of at least three separate transfections performed in triplicate. To be considered significant, each value had to be at least three times over the background level caused by the reaction buffer used (usually corresponding to 0.15% chloramphenicol conversion). Student’s t-test was performed for comparison of the groups. Differences were considered statistically significant at P < 0.05. All data are expressed as mean ± SD.

Nuclear Extracts, Electrophoretic Mobility Shift Assays, and Supershift Experiments
Crude nuclear extracts were prepared from midconfluent RCECs (5 x 104 cells/cm2 cultured for 72 hours usually yields almost 70% coverage of the culture flasks) grown either on BSA- (2% BSA in PBS) or LM-coated culture dishes, as detailed previously.55 Electrophoretic mobility shift assays (EMSAs) were conducted as described30 by using the Sp1 oligomer as a probe and 5 µg nuclear proteins. When indicated, unlabeled oligomers bearing the sequence of various target sites for known transcription factors (SP1p, Sp1d, Sp1pa, Sp1, NFI, AP-1) were added as unlabeled competitors (50-, 100-, 125- and 500-fold molar excesses) during the assay. DNA-protein complexes were then separated by gel electrophoresis through 6% native polyacrylamide gels run against Tris-glycine buffer.56 Supershift experiments in EMSA were conducted by incubation of 5 µg nuclear proteins from RCECs in the presence of no or 2 µL polyclonal antibodies raised against the transcription factors Sp1 and Sp3 (Santa Cruz Biotechnology, Inc.).

SDS-PAGE and Western Blot
Approximately 30 µg protein was added to 1 vol sample buffer (6 M urea, 63 mM Tris [pH 6.8], 10% [vol/vol] glycerol, 1% SDS, 0.00125% [wt/vol] bromophenol blue, 300 mM ß-mercaptoethanol) and was size-fractionated on a 10% SDS-polyacrylamide minigel before transfer to a nitrocellulose filter. The blot was then washed in TS and TSM buffers, as described.30 A 1:5000 dilution of a rabbit polyclonal antibody raised against Sp1 or Sp3 was added, and incubation proceeded for 2 hours at 22°C. The blot was then washed and incubated with a 1:1000 dilution of a peroxidase-conjugated goat anti-rabbit immunoglobulin G (Jackson ImmunoResearch Laboratories, Inc., Bar Harbor, ME), and immunoreactive complexes were revealed with the use of Western blot chemiluminescence reagents (Amersham Biosciences, Arlington Heights, IL), as recently described.30

RT-PCR and Northern Blot Analyses
Total RNA was isolated from midconfluent RCECs grown on BSA or on LM-coated culture plates using a reagent (Tri Reagent; Molecular Research Center, Inc., Cincinnati, OH) and was reverse transcribed using a transcriptase kit (Superscript II; Gibco-BRL), as recently detailed.52 The resultant newly synthesized first-strand cDNAs were column purified (QIAquick nucleotide removal kit; Qiagen, Santa Clarita, CA) and used for PCR amplification of the {alpha}6 integrin subunit transcript and the 18S ribosomal RNA. The DNA sequence of both the 5' and the 3' template primers for {alpha}6 (5' primer, CAAGATGGCTACCCAGATAT-bp; 3' primer, CTGAATCTGAGAGGGAACCA-bp; PCR product, 210 bp) was derived from the corresponding human {alpha}6 integrin gene (GenBank accession no., NM 000210). Oligonucleotide primers for the amplification of the 18S ribosomal RNA were provided (Quantum RNA 18S Internal Standards kit; Ambion Inc., Austin, TX). Taq polymerase (Pharmacia-LKB, Uppsala, Sweden) was selected for PCR amplification. Cycle parameters were the same for all primers used (denaturation 94°C, 30 seconds; annealing 58°C, 30 seconds; extension 72°C, 30 seconds) with an identical number of cycles (24, 26, 28, 30, 32, and 34 cycles) for both sets of primers. PCR-amplified DNAs were fractionated on a 2% agarose gel, and their positions were revealed by ethidium bromide staining. The gel photograph was scanned (Visage 110S Bioimage analyzer; Millipore) to quantify the alterations in the amount of the {alpha}6 and the 18S PCR-amplified fragments.

Northern blot analyses were conducted on total RNA isolated from midconfluent RCECs grown on BSA- or LM-coated culture plates, as detailed. Total RNA was size-fractionated on a 1.2% formaldehyde-agarose gel and blotted onto a Hybond-N+ membrane (Amersham Canada, Oakville, ON, Canada), as described elsewhere. The membrane was then hybridized at 65°C in buffer (PerfectHybrid Plus Hybridization; Sigma). Blots were washed once at 25°C in 2x SSC-0.1% SDS (1x SSC is 150 mM NaCl; 15 mM sodium citrate) and twice at 50°C in 0.2x SSC-0.1% SDS. The labeled probe used for hybridization consisted of a 665-bp EcoRI–EcoRI restriction fragment derived from the {alpha}6 cDNA. Membranes were autoradiographed at –80°C for 18 hours before development.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
DNAse I Footprinting of the Sp1 Binding Sites along the Promoter of the {alpha}6 Integrin Gene Subunit
To determine precisely where Sp1 binds along the {alpha}6 integrin subunit gene promoter, in vitro DNAse I footprinting was performed using a recombinant preparation of Sp1. The DNA sequence, located between positions +76 to –352 and constituting the entire {alpha}6 promoter, was examined on both strands for Sp1 binding. Two distinct target sites for Sp1 were identified along the {alpha}6 promoter sequence: a proximal site, located between positions –38 to –62 (Sp1p; Fig. 1A and also depicted on Fig. 1C ), and a more distal site, located between positions –195 and –215 (Sp1d; Fig. 1B and also depicted on Fig. 1C ). No binding site for Sp1 except Sp1p and Sp1d could be identified on the {alpha}6 promoter under the experimental conditions used.


Figure 1
View larger version (43K):
[in this window]
[in a new window]

 
FIGURE 1. DNAse I footprinting of Sp1 binding to the {alpha}6 gene promoter. (A) A preparation of recombinant Sp1 (1–10 µL) was incubated with a 217-bp {alpha}6 probe labeled on either the top (Top) or the bottom strand (Bottom) and subjected to DNAse I digestion. The digestion products were then analyzed by gel electrophoresis through an 8% sequencing gel. The position of a promoter proximal Sp1 protected site (Sp1p) is indicated for both the top and bottom strands. G, Maxam and Gilbert G sequencing ladder; C, labeled probe incubated with DNAse I but without recombinant Sp1. (B) Same as in (A) except that the labeled probe consisted of a 430-bp HindIII-KpnI DNA fragment from the {alpha}6 promoter 5' end-labeled on either its bottom or top strand. The position of a promoter distal Sp1 protected site (Sp1d) is indicated for both the bottom and top strands. (C) Positioning of the DNAse I footprinted Sp1 sites along the {alpha}6 promoter sequence. The positions of proximal (Sp1p) and distal (Sp1d) Sp1 target sites (boxes) relative to the {alpha}6 mRNA start site (identified as +1) are provided, along with the {alpha}6 promoter 5' end point from the recombinant constructs {alpha}6–84, {alpha}6–141, {alpha}6–181, and {alpha}6–352.

 
Regulatory Influence Played by Both the Sp1p and the Sp1d Sites on {alpha}6 Promoter Activity
To assess the functional relevance of the proximal and distal Sp1 sites, transfection of recombinant constructs bearing the CAT reporter gene fused to DNA segments from the {alpha}6 promoter bearing the proximal or both the proximal and the distal Sp1 sites was conducted into primary cultured cells (HSFs, HSKs, RCECs) and established tissue cultured cells (HeLa, ARPE19). All these cells were shown to express the {alpha}6 integrin subunit to varying degrees in the following order: RCECs > HSKs > ARPE19/HeLa > HSFs, as revealed by FACS analysis (Fig. 2) . As shown on Figure 3 , maximal basal promoter function is ensured by the first 84 bp located immediately upstream of the {alpha}6 mRNA start site (in plasmid {alpha}6–84) in all types of transfected cells. Surprisingly, extending the 5' end further up to position –352 to include the Sp1d site resulted in a dramatic reduction in CAT activity on transfection of the plasmid {alpha}6–352 into all types of cells (near 5-, 3-, 15-, 9-, and 50-fold reduction relative to the level directed by {alpha}6–84 in RCEC (Fig. 3B) , HSK (Fig. 3C) , HeLa (Fig. 3D) , ARPE19 (Fig. 3E) , and HSF (Fig. 3F) cells, respectively. Elongating the 5' end up to position –430 or –590 did not result in CAT activities statistically different from those measured with the {alpha}6–352 construct when transfected in RCECs and in HeLa cells (data not shown), suggesting that most of the regulatory elements required for the transcription of the {alpha}6 gene are located downstream from position –352. In addition, comparison of CAT activity yielded by the transfection of the {alpha}6–84 construct clearly indicated that the strength of the {alpha}6 promoter is higher in RCECs than in any of the other cell types transfected (32,118 ± 4941, 17,301 ± 3818, 6584 ± 1353, 1219 ± 455, and 60 ± 16 in RCECs, HSKs, HeLa, ARPE-19 and HSFs cells, respectively; similar results were observed with the {alpha}6–352 construct).


Figure 2
View larger version (12K):
[in this window]
[in a new window]

 
FIGURE 2. FACS analysis of integrin {alpha}6 expression in primary cultured and established tissue culture cells. Expression of the {alpha}6 integrin subunit was monitored by FACS analyses in primary cultures of RCEC, HSK, and HSF cells and in established HeLa and ARPE19 cells. Results are expressed as low (+) to very strong (++++) expression of {alpha}6 (bottom right table). Typical histograms of ++++ (RCECs), ++ (HeLa), and + (HSFs) are also provided. Values presented are from four individual measurements from two different batches of cells.

 

Figure 3
View larger version (23K):
[in this window]
[in a new window]

 
FIGURE 3. Transfection analyses in primary and established tissue culture cells. (A) Schematic representation of the recombinant {alpha}6/CAT constructs used in this study. Positions of proximal (Sp1p) and distal (Sp1d) Sp1 target sites identified by DNAse I footprinting are indicated along with the 5' end of each of the {alpha}6 promoter segment contained on the recombinant construct. Mutations that disrupt binding of Sp1 to proximal or distal Sp1 sites (in plasmids {alpha}6–84/mSp1p, {alpha}6–352/mSp1p, and {alpha}6–352/mSp1d), or both (in {alpha}6–352/mSp1pd), are indicated by the removal of the corresponding Sp1 box. (BF) Site-directed mutational analysis of Sp1p and Sp1d. Wild-type constructs {alpha}6–84 and {alpha}6–352, and their derivatives bearing mutations into either Sp1p ({alpha}6–84/mSp1p and {alpha}6–352/mSp1p) or Sp1d ({alpha}6–352/mSp1d), or both Sp1 sites ({alpha}6–352/mSp1pd), were transfected into primary cultured cells (RCECs, B; HSKs, C; HSFs, F) or established tissue culture cells (HeLa, D; ARPE19, E). Cells were then harvested, and CAT activity was determined and normalized to secreted hGH. SD is provided.

 
We then exploited site-directed mutagenesis to establish the individual contribution of Sp1p and Sp1d in the transcription directed by the {alpha}6 gene promoter. As shown on Figure 3 , mutating the Sp1p site in the basal {alpha}6 promoter from the parental plasmid {alpha}6–84 (to yield the {alpha}6–84/mSp1p mutated derivative) resulted in dramatic reductions in CAT activity on transfection of primary cultured cells and established tissue culture cells (24-, 29-, 27-, 14-, and 150-fold reduction in RCECs, HSKs, HeLa, ARPE19, and HSFs, respectively). However, mutating the Sp1p site in the context of the longer construct {alpha}6–352 (which bears Sp1p and Sp1d) had a statistically significant influence on the {alpha}6 promoter activity only in RCEC (40% reduction) and HSK (77% reduction) cells. Similarly, mutations that abolish the Sp1d site in the construct {alpha}6–352/mSp1d only modestly reduced {alpha}6 promoter activity by 48% in RCECs, whereas it had no influence in the remaining cell types. On the other hand, mutating both the Sp1p and the Sp1d sites in {alpha}6–352/mSp1pd severely reduced {alpha}6 promoter activity in all types of cells (from threefold in ARPE-19 to undetectable level in HSFs). These results suggest that a single, intact Sp1 site is required to ensure basal transcription directed by the {alpha}6 promoter in all cell lines tested and that negative regulatory elements that restrict promoter activity must be present along the –84/–352 segment from the {alpha}6 promoter.

To evaluate the respective contribution of Sp1 and Sp3 on the activity directed by the {alpha}6 Sp1p and the Sp1d sites, cotransfection experiments were conducted into Drosophila SL2 Schneider cells. These cells have been reported to be deficient in producing these transcription factors and many others expressed in higher eukaryotes, making them an ideal system for studying gene expression or transcription factors function (for a review, see Suske57 ). The plasmids {alpha}6–141 or {alpha}6–352 or their derivatives—which bear mutations into Sp1p ({alpha}6–141/mSp1p and {alpha}6–352/mSp1p), Sp1d ({alpha}6–352/mSp1d), or both sites ({alpha}6–352/mSp1pd)—were cotransfected into Schneider cells alone or with recombinant plasmids (pPacSp1 and pPacSp3) containing Sp1 or Sp3 cDNA under the control of the Drosophila actin gene promoter, therefore ensuring high levels of both these proteins in Schneider cells. Preliminary transfection experiments indicated that neither {alpha}6–141 nor {alpha}6–352 could sustain basal promoter activity when individually transfected into Schneider cells in the absence of Sp1 and Sp3. However, when cotransfected along with pPacSp1, 38- and 68-fold increases in promoter activity were observed with the plasmids {alpha}6–141 and {alpha}6–352, respectively (Fig. 4) . Mutations that eliminated the Sp1p site did not completely abolish Sp1 responsiveness because the {alpha}6 promoter preserved 29% of its activity with the {alpha}6–141/mSp1p construct and approximately 75% with {alpha}6–352/mSp1p. On the other hand, responsiveness toward Sp3 was much lower than that observed with Sp1 (sevenfold and threefold increases in CAT activity when pPacSp3 was cotransfected along with {alpha}6–141 and {alpha}6–352, respectively). Mutating the Sp1p site into both constructs entirely abolished promoter activity in SL2 cells, whereas disrupting Sp1d had no influence at all on the Sp3 responsiveness of the {alpha}6 promoter (Fig. 4) . Surprisingly, mutations that disrupt the Sp1d site in the {alpha}6–352/mSp1d construct did not suppress, but rather stimulated, {alpha}6 promoter function when cotransfected with pPacSp1 in SL2 cells. No such effect was observed with Sp3. Cotransfection of pPacSp1 and pPacSp3, together with the {alpha}6 promoter constructs, provided evidence that Sp1 and Sp3 do not function synergistically to modulate the transcriptional activity directed by the {alpha}6 promoter. At the most, a weak additive effect is observed when the {alpha}6–352 construct is cotransfected along with both the Sp1 and Sp3 expression vectors.


Figure 4
View larger version (29K):
[in this window]
[in a new window]

 
FIGURE 4. Transfections in Drosophila SL2 Schneider cells. Both the recombinant plasmids {alpha}6–141 (which bears only the Sp1p site) and {alpha}6–352 (which bears both the Sp1p and the Sp1d sites) and their Sp1-mutated derivatives ({alpha}6–141/mSp1p, {alpha}6–352/mSp1p, {alpha}6–352/mSp1d, and {alpha}6–352/mSp1pd) were transfected alone or with pPacSp1 (Sp1), pPacSp3 (Sp3), or both (Sp1/Sp3) into Drosophila SL2 Schneider cells. Cells were harvested 48 hours later, and CAT activities (expressed as fold activity relative to the level directed by the {alpha}6–141 or the {alpha}6–352 promoter constructs alone) was determined and normalized to ß-gal. SD is also provided.

 
Sp1 Binds to an Alternative Target Site when the Sp1p Site Is Mutated In Vitro
Only two Sp1 target sites were initially identified through DNAse I footprinting along the {alpha}6 promoter (Fig. 1) . However, the high residual {alpha}6 promoter activity observed in SL2 cells when the Sp1p and Sp1d sites were mutated, individually or in combination, suggested that Sp1 might have the ability to bind other alternative sequences with a lower affinity when it is prevented from interacting with its primary target sites. To investigate such a possibility, DNAse I footprinting was repeated with the Sp1p-unmutated {alpha}6 promoter fragment used in Figure 1 (as a control) or with a similar fragment bearing the mutated Sp1p site as labeled probes. Incubation of the labeled probe that bore an intact Sp1p site with Sp1 yielded the same protected site on the top (Fig. 5A) and the bottom (Fig. 5B) strands as that identified previously (Fig. 1) . However, when incubated with the labeled probe bearing the mutated Sp1p site, Sp1 could still bind, though with a lower affinity, to a stretch of sequence located immediately 5' from the Sp1p site to yield visible DNAse I protection (Sp1pa) on both strands of the labeled probe. Examination of the Sp1pa site revealed that it has primarily a GA-rich structure (Fig. 5C) rather than the typical GC- or GT-rich structure normally found in high-affinity Sp1 sites. Competition experiments in EMSA were conducted next to more precisely define the affinity of Sp1 toward each target site identified for this transcription factor in the {alpha}6 promoter. The oligonucleotide bearing the high-affinity binding site for Sp1 was used as the labeled probe during these assays (Fig. 6A) . Incubation of crude nuclear proteins from midconfluent RCECs with the Sp1-labeled probe yielded DNA-protein complexes characteristic of Sp1 and Sp3 binding to their GC-rich target site (Fig. 6B) . Formation of these complexes was almost entirely prevented by the addition of a 50-fold molar excess of the oligonucleotide bearing either the high-affinity Sp1 site (Sp1; 86% and 95% reduction of binding at 50- and 100-fold molar excess, respectively) or that from the {alpha}6 Sp1 proximal site (Sp1p; 91% and 94% reduction of binding at 50- and 100-fold molar excess, respectively). However, neither the Sp1d (41% and 58% reduction of binding at 50- and 100-fold molar excess, respectively) nor the Sp1pa site (32% and 63% reduction of binding at 50- and 100-fold molar excess, respectively) was as effective as the Sp1p site for competing with the formation of the Sp1/Sp3 complexes in EMSA, as revealed by PhosphorImager analysis of the Sp1/Sp3 DNA-protein complexes. On average, Sp1d and Sp1pa were approximately eight times less efficient in competing with the formation of the Sp1/Sp3 complexes when used at a 100-fold molar excess than Sp1p. We therefore conclude that Sp1 binds strongly to the Sp1p site but only weakly to either the Sp1d or the Sp1pa site in the {alpha}6 gene promoter.


Figure 5
View larger version (42K):
[in this window]
[in a new window]

 
FIGURE 5. DNAse I footprinting of an Sp1 alternative target site on the Sp1p-mutated {alpha}6 promoter. Recombinant Sp1 (2, 5, or 10 µL) was incubated with the 217-bp {alpha}6 probe used in Figure 1A , which bears either an intact (wt) or a mutated (mutant) Sp1p site and 5' end-labeled on either the top (A) or the bottom strand (B). DNA-protein complexes were then subjected to DNAse I digestion, and the products were analyzed by gel electrophoresis through an 8% sequencing gel. The position of the promoter proximal Sp1 protected site (Sp1p) identified on the wild-type promoter fragment (wt) is indicated, along with that of an alternative Sp1 target site (Sp1pa) identified on the labeled probe bearing mutations in the Sp1p site (mutant). G, Maxam and Gilbert G sequencing ladder; C, labeled probe incubated with DNAse I but without recombinant Sp1. (C) Same as in Figure 1C except that the position of the alternative Sp1 site (Sp1pa) is indicated relative to the {alpha}6 mRNA start site (identified as +1).

 

Figure 6
View larger version (83K):
[in this window]
[in a new window]

 
FIGURE 6. EMSA analysis of Sp1 binding to the Sp1 sites from the {alpha}6 promoter. (A) DNA sequence of the various Sp1 oligonucleotides used in the EMSA. (B) Crude nuclear proteins (5 µg) from RCECs grown on BSA were incubated with the Sp1-labeled probe either alone (C) or in the presence of double-stranded oligonucleotides bearing the sequence of either the Sp1p or Sp1d sites identified in the {alpha}6 promoter, or that of the alternative Sp1pa site, as unlabeled competitors. Oligonucleotides bearing the high-affinity binding sites for the unrelated transcription factors NFI and E2F1 were also used as negative controls for the competition experiment. Formation of the DNA-protein complexes was then monitored by EMSA. The position of the Sp1 and Sp3 complexes is shown. P, labeled probe alone; U, unbound fraction of the probe.

 
Influence of Laminin on the Activity Directed by the {alpha}6 Gene Promoter
Increased secretion of LM occurs late in the process of corneal wound healing. It follows that of the temporary FN matrix, which peaks a few hours after corneal injury. We demonstrated previously that expression of the gene encoding the FN-binding integrin subunit {alpha}5 responds positively to the presence of FN when RCECs are grown on FN-coated culture plates.30 We therefore examined whether LM could similarly alter the activity directed by the {alpha}6 gene promoter in vitro in RCECs grown in the presence of LM-coated culture plates. LM deposition was accomplished after a model developed by Nguyen et al.42 in which culture plates are first seeded with keratinocytes from the skin that are known for their ability to secrete substantial amounts of LM (predominantly LM-5).42 58 59 60 Keratinocytes were cultured until they reached varying cell densities for various periods of time and then were removed from the culture plates before their reseeding with RCECs, which were grown to midconfluence before they were transfected. As a control, culture plates were also coated with 8 µg/cm2 FN before seeding with RCECs.

Interestingly, transfection of the {alpha}6–181 plasmid into RCECs grown on LM-coated culture plates resulted in repression of the {alpha}6 promoter activity; maximum (eightfold) repression was reached when skin keratinocytes were maintained at after confluence for 5 days before their removal, though this result cannot be considered statistically different from the other conditions used (Fig. 7A) . On the contrary, transfection of {alpha}6–181 in RCECs that have been grown on FN-coated culture plates resulted not in a reduction but rather in a nearly threefold increase in {alpha}6 promoter activity (Fig. 7A) . To test whether other types of LM will trigger different regulatory responses on the {alpha}6 promoter activity, we substituted skin keratinocytes with human colon adenocarcinoma Caco-2 cells because these cells were reported to secrete primarily LM-10.43 As shown on Figure 7B , growing RCECs on LM-10 also resulted in weaker, but significant, repression of {alpha}6 promoter function. However, this repression was dependent on the seeding density of RCECs because no repression was observed when cells were seeded at 2.5 x 104 RCECs/cm2, whereas a 40% reduction was observed at 7.5 x 104 RCECs/cm2. Although skin keratinocytes and Caco-2 cells were shown primarily to secrete LM-5 and LM-10, respectively, in the cell environment, we could not exclude the possibility that they may also secrete other components from the ECM. To validate the results obtained with the keratinocyte- and Caco-2-secreted LMs, RCECs were also grown on culture plates coated with increasing concentrations of a commercial preparation of LM type-1 (LM-1) as a control. As shown on Figure 7C , LM-1 could also downregulate, though to a much lower level than with LM from skin keratinocytes, the expression directed by the {alpha}6 promoter contained on the {alpha}6–181 construct, validating the use of keratinocyte-mediated secretion of LM as a suitable model for the remaining experiments. Extending the {alpha}6 promoter 5' further from position –181 did not result in any further LM-mediated repression (Fig. 7D) . In addition, deletion of the {alpha}6 promoter segment located from position –181 to –84 (in plasmid {alpha}6–84) had no influence on the repression by LM, suggesting that LM-responsive sequences are located somewhere between the {alpha}6 mRNA start site and position –84.


Figure 7
View larger version (22K):
[in this window]
[in a new window]

 
FIGURE 7. Transfection of the {alpha}6 promoter in RCECs and HCECs grown in the presence of LM. LM-producing dermal keratinocytes (A) or colon carcinoma Caco-2 cells (B) were grown to 30%, 70%, or 100% cell density for 1, 3, 5, and 10 days (for skin keratinocytes) or to 100% confluence for 25 days (for Caco-2). Keratinocytes and Caco-2 cells were then completely removed, and the culture plates were immediately reseeded with RCECs (2.5 x 104/cm2 on LM from skin keratinocytes and 2.5 x 104, 5 x 104, and 7.5 x 104/cm2 on LM from Caco-2 cells) that were grown to midconfluence before transfection with the recombinant plasmid {alpha}6–181. Negative controls (–LM) correspond to RCECs seeded on culture plates coated with BSA. CAT activities were measured and expressed relative to the level directed by {alpha}6–181 transfected in cells grown without LM. SD is also provided. (C) RCECs were plated on culture plates coated with BSA (used as a negative control; –LM) or with varying concentrations of a commercial preparation of LM type 1 (0.5–8 µg/cm2) before transfection with the plasmid {alpha}6–181, as in panel (A). (D) Dermal keratinocytes were grown on culture plates until they reached 100% confluence for 5 days and then were completely removed. Culture plates were reseeded with RCECs before they were transfected with the recombinant plasmids {alpha}6–84, {alpha}6–141, {alpha}6–181, {alpha}6–352, {alpha}6–430, and {alpha}6–590. CAT activities were measured and normalized as in Figure 2 and are expressed relative to the level directed when transfected in RCECs without LM. (E) Same as in panel (D), except that LM-coated plates were reseeded with RCECs (as a control) and HCECs at P2 or P3 before transfection with the {alpha}6–181 recombinant construct. As negative controls, RCECs and HCECs were also seeded on BSA before transfection with {alpha}6–181 (–LM).

 
To exclude the possibility that the LM-mediated negative influence on the {alpha}6 promoter might be typical only of RCECs, similar experiments were conducted on human corneal epithelial cells cultured from the corneal limbus obtained from the eyes of a healthy donor (HCECs) and grown to either passage (P) 2 or P3. As with RCECs, LM resulted in a severe downregulation of {alpha}6 promoter activity in HCECs (Fig. 7E) . However, the amplitude of this LM-mediated repression varied considerably with the number of passages reached by these cells. Indeed, a dramatic 25-fold reduction of {alpha}6 promoter function was observed when P2 HCECs were grown on LM. However, expanding these cells for one more passage, at P3, considerably reduced the amplitude of this repression to fivefold, consistent with the abrupt terminal differentiation observed in HCECs; most of them cannot be cultured beyond P3 or P4.37 38

Laminin Alters the Nuclear Level of Sp1 and Sp3 in RCECs
After we established that Sp1 and Sp3 contribute to the transcription of the {alpha}6 gene by interacting with proximal and distal Sp1p and Sp1d sites, respectively, we reasoned that LM may exert its repressive influence by altering the nuclear level of each transcription factor. Crude nuclear extracts were obtained from RCECs grown to midconfluence (near 80% coverage of the plate) on culture plates coated with BSA (which is used as a negative control) or with LM and were examined in EMSA for their ability to sustain the binding of both Sp1 and Sp3 to a labeled probe bearing a high-affinity target site for these transcription factors. As shown on Figure 8A , shifted DNA-protein complexes with electrophoretic mobilities identical to those reported for Sp1 and Sp3 could easily be observed in the nuclear extract from RCECs grown solely on BSA (–LM). Specificity of the formation of these complexes was further confirmed through competition experiments in EMSA. Indeed, only the unlabeled Sp1 oligonucleotide, but not the oligomers bearing the target sites for the unrelated transcription factor NFI or AP-1, could compete for the formation of the Sp1/Sp3 complexes (Fig. 8A , right). The identity of the nuclear proteins yielding these complexes as Sp1 and Sp3 was further verified by supershift experiments in EMSA. As shown on Figure 8B (left, –LM), adding a polyclonal antibody directed against Sp1 dramatically reduced the formation of the slowest shifted complex on gel without altering that of the faster migrating complex. On the other hand, adding an Sp3 polyclonal antibody reduced the formation of the slow-migrating complex but totally prevented the formation of the faster one. Both antibodies generated slow-migrating, supershifted complexes (SCs) that corresponded to the recognition of the Sp1 or the Sp3 protein component from the DNA-protein complexes detected on the gel by the Sp1 and Sp3 antibodies, respectively. These results suggest that Sp1 and Sp3 are constituents of the more intense, slow-migrating complex seen in EMSA, whereas the less intense, faster migrating complex is exclusively constituted of Sp3 bound to the labeled probe. Both the slow- and the fast-migrating complexes disappeared when incubated along with both the Sp1 and the Sp3 antibodies (Sp1/Sp3Abs; Fig. 8B , left).


Figure 8
View larger version (74K):
[in this window]
[in a new window]

 
FIGURE 8. Expression of Sp1 and Sp3 in RCECs grown on LM and FN. (A) EMSA analysis of Sp1 binding in RCECs cultured on LM-coated plates. Crude nuclear proteins (5 µg) from RCECs grown on BSA (–LM) or LM-coated culture plates (precultured with skin keratinocytes for 5 days before removal; +LM) were incubated with the Sp1-labeled probe (left). Where indicated, double-stranded oligonucleotides bearing high-affinity binding sites for the transcription factors Sp1, NFI, and AP-1 were added as unlabeled competitors (right). Formation of the DNA-protein complexes was then monitored by EMSA. The position of the Sp1 and Sp3 complexes is shown. P, labeled probe alone; U, unbound fraction of the probe. (B) Supershift analysis in EMSA. Nuclear proteins from RCECs grown on BSA (–LM) or on LM (+LM) were incubated with the Sp1-labeled probe in the presence of antibodies directed against Sp1 or Sp3, either individually (Sp1Ab, Sp3Ab) or in combination (Sp1/Sp3Abs). Positions of the Sp1 and Sp3 DNA-protein complexes were then revealed by EMSA, as in panel (A). SC, supershifted complexes of low electrophoretic mobility that correspond to the binding of the Sp-antibodies to the Sp1- and Sp3-DNA complexes; C, positive control in which the labeled probe was incubated with proteins but without antibodies. (C) Comparative influence of the ECM components LM and FN on the DNA-binding properties of Sp1/Sp3. Nuclear proteins (5 µg) from RCECs grown on BSA (–FN or –LM) or on culture plates coated with either LM (+LM) or FN (+FN) were incubated with the Sp1-labeled probe before analysis of the complexes formed by EMSA. (D) Approximately 30 µg nuclear proteins from the extracts used in (C) were examined in Western blot analyses using the Sp1 and Sp3 antisera. Positions of the molecular mass markers are shown.

 
To eliminate the possibility that the LM influence on Sp1 might have resulted from a sporadic event, crude nuclear extracts were prepared from RCECs grown to midconfluence on either LM- or FN-coated culture plates as a control. As shown on Figure 8C (left), recognition of the Sp1-labeled probe by both Sp1 and Sp3 was substantially increased in RCECs grown in the presence of FN, as previously reported.30 On the other hand, binding of both these proteins was again dramatically reduced when cells were grown on LM-coated culture plates (Fig. 8C , right). Western blot analyses were then conducted to discern whether these alterations in the ability of Sp1 to recognize its target probe when cells were grown on FN or LM resulted from changes in the affinity of these proteins toward their target sites or from corresponding alterations in the total amount of each individual protein. As we previously reported,30 culturing cells on FN did not change the amount of Sp1 or Sp3 proteins expressed by RCECs, a clear indication that alterations in the affinity of Sp1 and Sp3 toward their target site accounted for the increased binding of Sp1/Sp3 observed in EMSA (+FN; Fig. 8D ). However, culturing RCECs in the presence of LM caused a dramatic reduction in the nuclear concentration of Sp1 and Sp3 (+LM; Fig. 8D ) that correlated perfectly with the reduced binding observed in EMSA for both these proteins. These results are consistent with the reduced {alpha}6 promoter activity observed in RCECs when cells were grown on LM-coated culture plates (Fig. 7) .

To determine whether the LM-mediated repression of the {alpha}6 promoter also translated to similar alterations in the expression of the endogenous {alpha}6 mRNA transcript, semiquantitative RT-PCR analyses were conducted. To eliminate the possibility that saturation of the PCR reaction is reached, amplifications were performed at 24, 26, 28, 30, 32, and 34 cycles. The specific {alpha}6 PCR product became detectable on gel after 24 cycles of amplification. Its formation happened to be nonlinear at 30 cycles and reached complete saturation after 32 cycles. PCR amplification of the {alpha}6 product remained fairly linear from 26 to 30 cycles of amplification (data not shown). As shown on Figure 9A , PCR amplification using both {alpha}6 primers yielded a single {alpha}6 DNA fragment of the correct size (210 bp) when total RNA was extracted from RCECs grown on BSA (only the result at 28 cycles of PCR amplification is shown). However, a significant reduction was observed when total RNA was obtained from cells grown on LM-coated culture plates. We then isolated total RNA from RCECs grown on either BSA or LM and examined the {alpha}6 mRNA transcript by Northern blot analysis. As shown on Figure 9B , a single mRNA species of approximately 5.5 kb that perfectly matched the size previously reported for the major {alpha}6 mRNA transcript22 was observed just below the 18S rRNA. As with RT-PCR, expression of the {alpha}6 transcript was considerably reduced when RNA was isolated from RCECs grown on LM, on normalization to GAPDH.


Figure 9
View larger version (25K):
[in this window]
[in a new window]

 
FIGURE 9. Influence of LM on the expression of the {alpha}6 mRNA transcript. (A) Total RNAs extracted from RCECs grown on BSA (–LM) or on LM-coated culture plates (+LM) were reverse transcribed and PCR amplified using synthetic, oligonucleotide primers specific to both the {alpha}6 and 18S ribosomal RNAs. Positions of the amplified 210-bp {alpha}6 ({alpha}6) and the 489-bp 18S fragments (18S) is indicated along with that of the most relevant markers (left). (B) Total RNA preparations used in (A) were subjected to analyses by Northern blot. Positions of the {alpha}6 5.5-kb mRNA is indicated, along with that of the 28S ribosomal RNA. As a control, the membrane was also hybridized with a 548-bp HindIII-XbaI fragment digested from the human glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) cDNA and used as a labeled probe for normalization of the {alpha}6 mRNA signal to that corresponding to GAPDH (1.2 kb).

 
As a further support of our in vitro results, binding of Sp1 and Sp3 was also examined in vivo by the ChIP assay on HCECs cultured on BSA or LM-coated culture plates (+LM). As additional controls, ChIP was also conducted on other transcription factors, such as NFI and E2F1, of which some (E2F1) are suspected to bind the {alpha}6 promoter.61 Antibodies against these transcription factors all enriched the {alpha}6 promoter sequences in HCECs, indicating that they are bound to this genomic area in vivo (Fig. 10A) . However, among them, the signal obtained with the Sp3 antibody clearly predominated. When ChIP was conducted on cells grown on LM, all four proteins again enriched the {alpha}6 promoter but with signal intensities different from HCECs grown on BSA. Indeed, normalization of the PCR amplification products resulting from the {alpha}6 promoter segment immunoprecipitated by each antibody to the input chromatin control indicated a clear reduction in the binding of Sp3 and E2F1 and a tendency of Sp1 to decrease as well when cells were grown on LM (Fig. 10B) . Occupancy of the {alpha}6 promoter by NFI in relation to the "input" was not altered by growing cells on LM.


Figure 10
View larger version (18K):
[in this window]
[in a new window]

 
FIGURE 10. In vivo ChIP analysis on the {alpha}6 promoter. (A) ChIP assays were performed on HCECs grown on either BSA or LM. Chromatin was isolated and immunoprecipitated with antibodies directed against the transcription factors Sp1, Sp3, NFI, and E2F1. PCR of the {alpha}6 (ITGA6) gene promoter was then carried out on the ChIP samples, along with a "no antibody" control (No Ab) that contains chromatin but no antibody, an "input" sample corresponding to 0.2% of the total input chromatin, and a "mock" sample that does not contain chromatin. PCR amplification of a gene segment located approximately 2000 bp upstream of the p21 promoter was also conducted on the same sample as a negative control for all immunoprecipitates. (B) Graph representing the amount of specific PCR products expressed as the percentage of antibody binding versus the amount of PCR product obtained using a standardized aliquot of input chromatin. The signal in the no-antibody lane corresponds to the nonspecific binding background and was subtracted from each sample.

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Tissue repair requires the adhesion of proliferating cells to the basement membrane and cell migration to cover the wound.62 The way wound healing of the corneal epithelium proceeds is basically the same for every type of tissue epithelium (for a review, see Midwood et al.63 ). In this study, we investigated the functions of Sp1 and Sp3 in the transcription of the LM-binding {alpha}6 integrin subunit gene in various primary cultured and established tissue culture cells. Both transcription factors were found to contribute in varying degree to the transcription of the {alpha}6 gene by interacting with two distinct target sites, Sp1p and Sp1d, along the promoter of the {alpha}6 gene. Most of all, culturing RCECs in the presence of LM caused a substantial reduction in the expression directed by the {alpha}6 promoter that resulted from a coordinated reduction in the level of expression of Sp1 and Sp3 in these cells.

Sp1 is the founding member of a Zn-finger family of transcription factors, the Sp family, which now includes nine Sp genes (Sp1-Sp9; for a review, see Zhao and Meng64 ). Sp1 is of a particular interest as its GC-rich target site is found in a very large number of eukaryotic genes, including many integrin subunit genes (for further details, see Zaniolo et al.65 ). Consequently, Sp1 is likely to mediate some, if not most, of the regulatory influences the many ECM components exert on the transcription of the integrin subunit genes. By exploiting in vitro DNAse I footprinting, two target sites for Sp1 and Sp3 were identified along the human {alpha}6 promoter; a proximal site (Sp1p, centered at position –50) located near the mRNA start site and a more distant site (Sp1d, centered at position –205). The position of the proximal Sp1 site identified in this study (–38 to –62) is consistent with that previously reported for this transcription factor,31 unlike the distal site, which has never before been reported. However, the affinity of Sp1 for this more distantly located target site proved to be eightfold lower than that of the proximal site, and its mutation alone had little influence on the basal promoter function in most types of transfected cells. On the other hand, when the Sp1p site was mutated in the shorter {alpha}6 promoter-bearing construct {alpha}6–84, dramatic reductions in basal promoter activity were observed in all types of cells. However, its mutation had marginal influence considering the longer construct that included an intact Sp1d site (in {alpha}6–352). It was only when both Sp1 sites were mutated that a substantial reduction in {alpha}6 promoter activity was observed in all types of cells, indicating that both Sp1 sites are redundant with each other. Yet, despite the mutation of both Sp1 sites, basal {alpha}6 promoter activity remained relatively high in most types of cells. Remarkably, when the proximal site was mutated, Sp1 was found to bind with a lower affinity to an alternative target site located immediately 5' of Sp1p. Examination of this sequence revealed that it contains a GA- and a GT-rich sequence. Sp1 and Sp3 have been reported to bind to GC-, GT-, or GA-rich target sites with nearly the same affinity66 and are therefore likely to bind the alternative Sp1pa GT- or GA-rich Sp1 sites identified in the {alpha}6 basal promoter. Use of an alternative degenerated site by Sp1 may explain the residual promoter activity observed despite that both the Sp1p and the Sp1d sites were mutated in the {alpha}6–352 construct. This constitutes a noteworthy evolutionary advantage for Sp1. Its ability to bind and use alternative low-affinity binding sites would ensure the maintenance of a minimal promoter activity when high-affinity sites are lost during the course of evolution.

Dramatic differences were observed in the level of {alpha}6 expression (evaluated by FACS analyses) and {alpha}6 promoter activity between primary cultured RCECs and HSKs, both of which expressed {alpha}6 to high levels, and HSFs, which barely directed any promoter activity at all (5755- and 5025-fold lower than in RCECs and HSKs, respectively, with the {alpha}6–352 construct). These results are consistent with basal corneal epithelial cells and skin keratinocytes, two epithelial-type cells, expressing high levels of the {alpha}6 integrin subunit while stromal fibroblasts from the cornea do not.9 23 38 60 67 68 69 70 71 By exploiting primary RCEC cultures to study the influence played by the ECM on the expression of integrin subunit genes, we previously reported dramatic increases in the activity directed by the promoter of the {alpha}4 and {alpha}5 integrins when these cells are grown in the presence of FN.30 72 In addition to {alpha}4 and {alpha}5, FN considerably increased (by approximately fivefold) the activity of the {alpha}6 promoter in in vitro cultures of RCECs (Fig. 7A) , consistent with the results reported by Grushkin-Lerner et al.22 Interestingly, human LM did not increase but rather reduced to various degrees the expression of the {alpha}6 promoter (and that of the {alpha}4 and {alpha}5 integrin gene promoters72 ), irrespective of whether corneal epithelial cells were primary cultured from rabbit or human eyes. Differences in the strength of LM repression between keratinocyte-secreted LM and commercially produced LM-1 may reside in the fact that skin keratinocytes primarily secrete type 5 LM, which is also the major LM isoform secreted during corneal wound healing. Binding of Sp1 and Sp3 to the {alpha}6 promoter primarily accounts for its transcription in the many types of cells transfected in the present study. Surprisingly, culturing RCECs in the presence of LM resulted in a reduction in Sp1 binding caused by a corresponding decrease in its expression at the protein level. The appearance of faster migrating DNA-protein complexes in EMSA (Figs. 8A 8B 8C , +LM) and much smaller protein products in Western blot (Fig. 8D , +LM), when cells are grown on LM but not on FN or BSA, indicate that both factors must be subjected to protein degradation by a yet unknown protease(s) that may become activated by the signal transduction pathway activated by the binding of LM to its integrin receptor subunit {alpha}6. Similar degradation of Sp1/Sp3 was demonstrated when RCECs reached quiescence at a high cell density.52 Interestingly, Sp1 expression has been shown to predominate during the G1 phase of the cell cycle and is then subjected to proteasome-dependent degradation before the S phase, a process thought to be dependent on the level of Sp1 phosphorylation.73 Consequently, LM, by reducing the level to which Sp1 and Sp3 are expressed in RCECs in vitro, also contributes to the reduction in the transcription directed by the {alpha}6 promoter when cells are grown on this ECM component.

Although the amount of intact Sp1 clearly decreases when corneal epithelial cells are grown on LM, only marginal reduction of {alpha}6 promoter occupation by Sp1 is observed in ChIP. However, ChIP is by no mean a reliable quantitative method. At the most, one may consider ChIP semiquantitative when repeated experiments yield reproducible results on normalization to the input DNA, as has been the case for Sp3 and E2F1 in the present study. We have shown previously that many of the Sp1/Sp3 cleavage products retain their ability to bind Sp1 target sites despite the truncations they bear in their N-terminal domain49 52 (see also Figs. 8B 8C , which show the appearance of fast-migrating DNA-protein complexes as Sp1 and Sp3 disappear when cells grow on LM). Therefore, one may assume that such Sp1/Sp3 degradation products will also bind the {alpha}6 promoter in vivo when examined by ChIP assays. Without the combined use of EMSA and Western blotting, ChIP would have failed to recognize these {alpha}6 promoter-bound proteins as degradation products of Sp1/Sp3 because it does not discriminate for changes in the molecular mass of these proteins. ChIP only requires that the epitope recognized by the antibody used for the immunoprecipitation step be preserved in the truncated proteins, which is precisely the case for Sp1 and Sp3; some of their corresponding degradation products are easily recognized by the Sp1 and Sp3 Abs in Western blot49 52 (also see Fig. 8D ). We must therefore consider ChIP for what it truly is: a qualitative method that tells us whether any given transcription factor binds in vivo to a particular gene regulatory area with a resolution range between 300 and 500 bp (which corresponds to the average size of the sonicated, cross-linked DNA used for the assay).

The finding that NFI binds the {alpha}6 promoter in ChIP assays, irrespective of whether HCECs are grown on LM, suggests that members from this family of transcription factors, which comprises four proteins—NFI-A, NFI-B, NFI-C, and NFI-X—may contribute to the extinction of {alpha}6 gene expression under this culture condition. Interestingly, members of the NFI family are reported to be as efficient as repressors74 75 76 as they are as activators77 78 of gene transcription. Through interactions with weak binding sites, NFI may regulate gene expression by its ability to cooperate or to compete with many transcription factors.74 79 NFI was reported to interact with and antagonize Sp1, resulting in the downregulation of platelet-derived growth factor (PDGF)-A gene expression.79 We recently reported that similar interference of Sp1 action by NFI might also account for the transcriptional repression of the PARP-174 80 and p21 genes.81 A search using computer databases for the identification of transcription factors target sites failed to identify any intact, prototypical NFI binding site in the proximal promoter of the {alpha}6 gene but did find a number of putative half-canonical target sites for this transcription factor (data not shown). Therefore, the possibility remains that NFI might bind these degenerated target sites because this transcription factor has been reported to bind half its canonical sequence82 in the basal promoter of many genes, including those from surfactant protein-C (SP-C83 ), 3ß-hydroxysteroid/dihydrodiol dehydrogenase (3ß-HSD/DD, AKR1C984 ), and metallothionein-I (MT-I85 ).

In addition to NFI and Sp1, the in vivo ChIP analyses evidenced the binding of E2F1 to the {alpha}6 promoter. Most interestingly, of all the transcription factors tested, E2F1 was the one whose binding to the {alpha}6 promoter was most diminished by the presence of LM on the culture plates. Members of the E2F family play a crucial role in the transactivation of G1/S transition-specific genes86 and are thereby required to ensure proper cell proliferation. By conducting a representational difference analysis to identify genes differentially expressed in E2F1–/– versus wild-type undifferentiated primary keratinocytes, D’Souza et al.61 identified four integrin gene products ({alpha}5, {alpha}6, ß1, ß4) of 11 distinct genes downregulated in E2F1-deficient cells, suggesting that their transcription is clearly modulated by E2F1. E2F1–/– knockout mice had a considerably reduced wound healing response after partial tail amputation, suggesting that the {alpha}5 and {alpha}6 integrin subunits must contribute to this process.61 D’Souza et al.61 were unable to reveal the existence of E2F-binding elements in the 5'-flanking sequence of this integrin gene. However, the need for a perfect prototypical E2F1 site (TTTSSCGC, in which S = C or G)87 in the {alpha}6 promoter is not an absolute requirement because only 12% of the E2F1 target sites occupied by this transcription factor in the human genome have the canonical binding motif, as recently revealed by high-density oligonucleotide tiling arrays.88 Other studies have shown the importance of preserving the central SSCGC for E2F binding,89 whereas binding can still be retained with a single mismatch in the three Ts.87 Therefore, we searched for E2F1 target sites in the {alpha}6 promoter that might have diverged from the consensus by one of the three Ts. Three such sites could be identified from positions –191 to –184 on the top strand (5'-TTcGCCGC-3') and from –113 to –106 (5'-GCGGGtAA-3') and –79 to –72 (5'-GCGCGcAA-3') on the bottom strand. Their true functional significance remains to be established.

Considering the results presented in this study, the binding of the {alpha}6ß4 integrin to its ligand LM is expected to trigger growth-regulatory signals (probably negative ones) completely distinct from those resulting from the binding of FN to the {alpha}5ß1 integrin. Although the positive influence of FN and collagen on cell migration is well documented, that of LM remains controversial because it has been reported to promote or to suppress cell adhesion and migration. Evidence points, however, toward a major role for LM in the suppression of cell growth and migration. Indeed, the overexpression of ß4 in a cell that lacks this integrin subunit slows down the migration of that cell.90 LM-5 densely deposited under the cell is suggested to contribute to the stabilization of the {alpha}6ß4 integrin binding to this ECM ligand. Retroviral-mediated siRNA suppression of LM-5 in an established oral squamous cell carcinoma (OSCC) cell line substantially enhanced the migratory, tumorigenic, and invasive properties of these cancer cells.91 Several breakdown products of LM-5, which is composed of three subunits ({alpha}3ß3{gamma}2), have been reported to exert different influences that may explain, at least in part, the paradoxical action of LM on cell migration. For instance, the proteolytic processing of the {alpha}3 chain of LM-5 by plasmin produces an LM-5 molecule that induces the assembly of hemidesmosomes and impedes cell migration.92 On the contrary, proteolytic processing of the {gamma}2 chain is related to the induction of cell migration.93 Therefore, the secretion of LM while FN declines during the wounding process might signal to epithelial cells the proper time to stop migrating by inducing the degradation of key transcription factors through the proteasome, such as Sp1, thereby shutting down expression of a large number of genes required for cell proliferation and adhesion. Another function LM might play, besides restricting cell migration, would be to stimulate the differentiation of the basal epithelial cells into suprabasal cells as they migrate toward the apical surface of the cornea through their vertical stratification.94 Recently, polycarbonic membranes coated with various ECM components were implanted on the wounded corneas of adult cats and were assessed for rapidity and for completeness and persistence of epithelial overgrowth.95 It turned out that FN, though efficient for wound closing, could not support persistent epithelial overgrowth, whereas LM, collagen type IV, and collagen type I were all effective in yielding multiple-layered epithelia. These results further support a role for FN in the migration of basal epithelial cells early in wound healing so that the wounded area becomes rapidly covered with epithelial cells, whereas LM, CI, and CIV would act at a later stage to favor differentiation and vertical stratification of the basal cells to reconstitute an intact corneal epithelium.

In summary, each component from the ECM appears to trigger specific transcriptional regulatory signals when taken individually. Some, such as FN and collagen type IV, mediate positive, cell density-specific influences on gene expression (reviewed in Ref. 72 ), whereas others, such as LM, suppress gene transcription. Investigating how they influence gene expression when used in combination should be particularly valuable to the understanding of tissue wound healing.


    Acknowledgements
 
The authors thank Claudia Fugère and Lucie Germain (Laboratoire d’Organogénèse Expérimentale [LOEX], Hôpital du Saint-Sacrement, CHA and Department of Surgery and Ophthalmology, Laval University, Québec, QC, Canada) for providing primary cultures of HSKs, HCECs, and HSFs. They also thank Vito Quaranta (Department of Cell Biology, The Scripps Research Institute, La Jolla, CA) for providing the complete {alpha}6 cDNA, and Jean-François Beaulieu (Centre Hospitalier de l’Université de Sherbrooke [CHUS], Sherbrooke, QC, Canada) for providing the Caco2/15 cells.


    Footnotes
 
Supported by the Canadian Institutes for Health Research (CIHR; Grant 37946) and the Vision Network of the Fonds de la Recherche en Santé du Québec (FRSQ). MG and FV hold Doctoral Research Awards from the FRSQ and the CIHR, respectively. SLG is a research scholar from the FRSQ.

Submitted for publication January 5, 2007; revised March 29, 2007; accepted June 12, 2007.

Disclosure: M. Gaudreault, None; F. Vigneault, None; S. Leclerc, None; S.L. Guérin, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Sylvain L. Guérin, Oncology and Molecular Endocrinology Research Center, Centre Hospitalier Universitaire de Québec and Laval University, 2705 Laurier Boulevard, Québec, G1V 4G2, Canada; sylvain.guerin{at}crchul.ulaval.ca.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Cotsarelis G, Cheng SZ, Dong G, Sun TT, Lavker RM. Existence of slow-cycling limbal epithelial basal cells that can be preferentially stimulated to proliferate: implications on epithelial stem cells. Cell. 1989;57:201–209.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  2. Schermer A, Galvin S, Sun TT. Differentiation-related expression of a major 64K corneal keratin in vivo and in culture suggests limbal location of corneal epithelial stem cells. J Cell Biol. 1986;103:49–62.[Abstract/Free Full Text]
  3. Crosson CE. Cellular Changes Following Epithelial Abrasion. 1989;3–14. Portofolio Publishing The Woodlands, TX.
  4. Murakami J, Nishida T, Otori T. Coordinated appearance of beta 1 integrins and fibronectin during corneal wound healing. J Lab Clin Med. 1992;120:86–93.[Web of Science][Medline][Order article via Infotrieve]
  5. Kang SJ, Kim EK, Kim HB. Expression and distribution of extracellular matrices during corneal wound healing after keratomileusis in rabbits. Ophthalmologica. 1999;213:20–24.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  6. Berman M, Manseau E, Law M, Aiken D. Ulceration is correlated with degradation of fibrin and fibronectin at the corneal surface. Invest Ophthalmol Vis Sci. 1983;24:1358–1366.[Abstract/Free Full Text]
  7. Nickeleit V, Kaufman AH, Zagachin L, Dutt JE, Foster CS, Colvin RB. Healing corneas express embryonic fibronectin isoforms in the epithelium, subepithelial stroma, and endothelium. Am J Pathol. 1996;149:549–558.[Abstract]
  8. Aumailley M, Bruckner-Tuderman L, Carter WG, et al. A simplified laminin nomenclature. Matrix Biol. 2005;24:326–332.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  9. Kurpakus MA, Daneshvar C, Davenport J, Kim A. Human corneal epithelial cell adhesion to laminins. Curr Eye Res. 1999;19:106–114.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  10. Tuori A, Uusitalo H, Burgeson RE, Terttunen J, Virtanen I. The immunohistochemical composition of the human corneal basement membrane. Cornea. 1996;15:286–294.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  11. Malinda KM, Kleinman HK. The laminins. Int J Biochem Cell Biol. 1996;28:957–959.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  12. Plow EF, Haas TA, Zhang L, Loftus J, Smith JW. Ligand binding to integrins. J Biol Chem. 2000;275:21785–21788.[Free Full Text]
  13. van der Flier A, Sonnenberg A. Function and interactions of integrins. Cell Tissue Res. 2001;305:285–298.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  14. Venter JC, Adams MD, Myers EW, et al. The sequence of the human genome. Science. 2001;291:1304–1351.[Abstract/Free Full Text]
  15. Hynes RO. Integrins: a family of cell surface receptors. Cell. 1987;48:549–554.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  16. Hynes RO. Integrins: versatility, modulation, and signaling in cell adhesion. Cell. 1992;69:11–25.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  17. Clark EA, Brugge JS. Integrins and signal transduction pathways: the road taken. Science. 1995;268:233–239.[Abstract/Free Full Text]
  18. Ekblom P. Receptors for laminins during epithelial morphogenesis. Curr Opin Cell Biol. 1996;8:700–706.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  19. Lee EC, Lotz MM, Steele GD, Jr, Mercurio AM. The integrin alpha 6 beta 4 is a laminin receptor. J Cell Biol. 1992;117:671–678.[Abstract/Free Full Text]
  20. Latvala T, Paallysaho T, Tervo K, Tervo T. Distribution of alpha 6 and beta 4 integrins following epithelial abrasion in the rabbit cornea. Acta Ophthalmol Scand. 1996;74:21–25.[Web of Science][Medline][Order article via Infotrieve]
  21. Latvala T, Tervo K, Tervo T. Reassembly of the alpha 6 beta 4 integrin and laminin in rabbit corneal basement membrane after excimer laser surgery: a 12-month follow-up. CLAO J. 1995;21:125–129.[Medline][Order article via Infotrieve]
  22. Grushkin-Lerner LS, Kewalramani R, Trinkaus-Randall V. Expression of integrin receptors on plasma membranes of primary corneal epithelial cells is matrix specific. Exp Eye Res. 1997;64:323–334.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  23. Stepp MA, Spurr-Michaud S, Tisdale A, Elwell J, Gipson IK. Alpha 6 beta 4 integrin heterodimer is a component of hemidesmosomes. Proc Natl Acad Sci USA. 1990;87:8970–8974.[Abstract/Free Full Text]
  24. Borradori L, Sonnenberg A. Structure and function of hemidesmosomes: more than simple adhesion complexes. J Invest Dermatol. 1999;112:411–418.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  25. Payne J, Gong H, Trinkaus-Randall V. Tyrosine phosphorylation: a critical component in the formation of hemidesmosomes. Cell Tissue Res. 2000;300:401–411.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  26. Stepp MA, Zhu L. Upregulation of alpha 9 integrin and tenascin during epithelial regeneration after debridement in the cornea. J Histochem Cytochem. 1997;45:189–201.[Abstract/Free Full Text]
  27. Stepp MA, Zhu L, Cranfill R. Changes in beta 4 integrin expression and localization in vivo in response to corneal epithelial injury. Invest Ophthalmol Vis Sci. 1996;37:1593–1601.[Abstract/Free Full Text]
  28. Paallysaho T, Tervo K, Tervo T, van Setten GB, Virtanen I. Distribution of integrins alpha 6 and beta 4 in the rabbit corneal epithelium after anterior keratectomy. Cornea. 1992;11:523–528.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  29. Suzuki K, Tanaka T, Enoki M, Nishida T. Coordinated reassembly of the basement membrane and junctional proteins during corneal epithelial wound healing. Invest Ophthalmol Vis Sci. 2000;41:2495–2500.[Abstract/Free Full Text]
  30. Larouche K, Leclerc S, Salesse C, Guerin SL. Expression of the alpha 5 integrin subunit gene promoter is positively regulated by the extracellular matrix component fibronectin through the transcription factor Sp1 in corneal epithelial cells in vitro. J Biol Chem. 2000;275:39182–39192.[Abstract/Free Full Text]
  31. Onishi T, Yamakawa K, Franco OE, et al. Mitogen-activated protein kinase pathway is involved in alpha6 integrin gene expression in androgen-independent prostate cancer cells: role of proximal Sp1 consensus sequence. Biochim Biophys Acta. 2001;1538:218–227.[Medline][Order article via Infotrieve]
  32. Lin CS, Chen Y, Huynh T, Kramer R. Identification of the human alpha6 integrin gene promoter. DNA Cell Biol. 1997;16:929–937.[Web of Science][Medline][Order article via Infotrieve]
  33. Nishida K, Kitazawa R, Mizuno K, Maeda S, Kitazawa S. Identification of regulatory elements of human alpha 6 integrin subunit gene. Biochem Biophys Res Commun. 1997;241:258–263.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  34. Gao JG, Mazella J, Tseng L. Activation of the human IGFBP-1 gene promoter by progestin and relaxin in primary culture of human endometrial stromal cells. Mol Cell Endocrinol. 1994;104:39–46.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  35. Park HM, Okumura J, Muramatsu T. Modulation of transcriptional activity of the chicken ovalbumin gene promoter in primary cultures of chicken oviduct cells: effects of putative regulatory elements in the 5'-flanking region. Biochem Mol Biol Int. 1995;36:811–816.[Web of Science][Medline][Order article via Infotrieve]
  36. Sun J, Oddoux C, Gilbert MT, et al. Pituitary-specific transcription factor (Pit-1) binding site in the human renin gene 5'-flanking DNA stimulates promoter activity in placental cell primary cultures and pituitary lactosomatotropic cell lines. Circ Res. 1994;75:624–629.[Abstract/Free Full Text]
  37. Gaudreault M, Carrier P, Larouche K, et al. Influence of sp1/sp3 expression on corneal epithelial cells proliferation and differentiation properties in reconstructed tissues. Invest Ophthalmol Vis Sci. 2003;44:1447–1457.[Abstract/Free Full Text]
  38. Germain L, Auger FA, Grandbois E, et al. Reconstructed human cornea produced in vitro by tissue engineering. Pathobiology. 1999;67:140–147.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  39. Boisjoly HM, Laplante C, Bernatchez SF, Salesse C, Giasson M, Joly MC. Effects of EGF, IL-1 and their combination on in vitro corneal epithelial wound closure and cell chemotaxis. Exp Eye Res. 1993;57:293–300.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  40. Masson-Gadais B, Fugere C, Paquet C, et al. The feeder layer-mediated extended lifetime of cultured human skin keratinocytes is associated with altered levels of the transcription factors Sp1 and Sp3. J Cell Physiol. 2006;206:831–842.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  41. Beaulieu JF, Quaroni A. Clonal analysis of sucrase-isomaltase expression in the human colon adenocarcinoma Caco-2 cells. Biochem J. 1991;280(pt 3)599–608.[Web of Science][Medline][Order article via Infotrieve]
  42. Nguyen BP, Ren XD, Schwartz MA, Carter WG. Ligation of integrin alpha 3beta 1 by laminin 5 at the wound edge activates Rho-dependent adhesion of leading keratinocytes on collagen. J Biol Chem. 2001;276:43860–43870.[Abstract/Free Full Text]
  43. Turck N, Gross I, Gendry P, et al. Laminin isoforms: biological roles and effects on the intracellular distribution of nuclear proteins in intestinal epithelial cells. Exp Cell Res. 2005;303:494–503.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  44. Orian-Rousseau V, Aberdam D, Rousselle P, et al. Human colonic cancer cells synthesize and adhere to laminin-5: their adhesion to laminin-5 involves multiple receptors among which is integrin alpha2beta1. J Cell Sci. 1998;111(pt 14)1993–2004.[Web of Science][Medline][Order article via Infotrieve]
  45. Regnault V, Rivat C, Geschier C, Stoltz JF. Human plasma fibronectin: comparison of methods for preparation of a concentrate for therapeutic use from different sources. [in French]Rev Fr Transfus Hemobiol. 1990;33:391–405.[Web of Science][Medline][Order article via Infotrieve]
  46. Dynan WS, Tjian R. The promoter-specific transcription factor Sp1 binds to upstream sequences in the SV40 early promoter. Cell. 1983;35:79–87.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  47. de Vries E, van Driel W, van den Heuvel SJ, van der Vliet PC. Contact point analysis of the HeLa nuclear factor I recognition site reveals symmetrical binding at one side of the DNA helix. EMBO J. 1987;6:161–168.[Web of Science][Medline][Order article via Infotrieve]
  48. Corbi AL, Jensen UB, Watt FM. The alpha2 and alpha5 integrin genes: identification of transcription factors that regulate promoter activity in epidermal keratinocytes. FEBS Lett. 2000;474:201–207.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  49. Robidoux S, Gosselin P, Harvey M, Leclerc S, Guerin SL. Transcription of the mouse secretory protease inhibitor p12 gene is activated by the developmentally regulated positive transcription factor Sp1. Mol Cell Biol. 1992;12:3796–3806.[Abstract/Free Full Text]
  50. Blais A, Monte D, Pouliot F, Labrie C. Regulation of the human cyclin-dependent kinase inhibitor p18INK4c by the transcription factors E2F1 and Sp1. J Biol Chem. 2002;277:31679–31693.[Abstract/Free Full Text]
  51. Oberley MJ, Farnham PJ. Probing chromatin immunoprecipitates with CpG-island microarrays to identify genomic sites occupied by DNA-binding proteins. Methods Enzymol. 2003;371:577–596.[Web of Science][Medline][Order article via Infotrieve]
  52. Gingras ME, Larouche K, Larouche N, Leclerc S, Salesse C, Guerin SL. Regulation of the integrin subunit alpha5 gene promoter by the transcription factors Sp1/Sp3 is influenced by the cell density in rabbit corneal epithelial cells. Invest Ophthalmol Vis Sci. 2003;44:3742–3755.[Abstract/Free Full Text]
  53. Selden RF, Howie KB, Rowe ME, Goodman HM, Moore DD. Human growth hormone as a reporter gene in regulation studies employing transient gene expression. Mol Cell Biol. 1986;6:3173–3179.[Abstract/Free Full Text]
  54. Pothier F, Ouellet M, Julien JP, Guerin SL. An improved CAT assay for promoter analysis in either transgenic mice or tissue culture cells. DNA Cell Biol. 1992;11:83–90.[Web of Science][Medline][Order article via Infotrieve]
  55. Roy RJ, Gosselin P, Guerin SL. A short protocol for micro-purification of nuclear proteins from whole animal tissue. BioTechniques. 1991;11:770–777.[Web of Science][Medline][Order article via Infotrieve]
  56. Schneider R, Gander I, Muller U, Mertz R, Winnacker EL. A sensitive and rapid gel retention assay for nuclear factor I and other DNA-binding proteins in crude nuclear extracts. Nucleic Acids Res. 1986;14:1303–1317.[Abstract/Free Full Text]
  57. Suske G. Transient transfection of Schneider cells in the study of transcription factors. Methods Mol Biol. 2000;130:175–187.[Medline][Order article via Infotrieve]
  58. Marinkovich MP, Verrando P, Keene DR, et al. Basement membrane proteins kalinin and nicein are structurally and immunologically identical. Lab Invest. 1993;69:295–299.[Web of Science][Medline][Order article via Infotrieve]
  59. Prunieras M, Regnier M, Fougere S, Woodley D. Keratinocytes synthesize basal-lamina proteins in culture. J Invest Dermatol. 1983;81(suppl)74s–81s.[CrossRef][Medline][Order article via Infotrieve]
  60. Zhang K, Kramer RH. Laminin 5 deposition promotes keratinocyte motility. Exp Cell Res. 1996;227:309–322.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  61. D’Souza SJ, Vespa A, Murkherjee S, Maher A, Pajak A, Dagnino L. E2F-1 is essential for normal epidermal wound repair. J Biol Chem. 2002;277:10626–10632.[Abstract/Free Full Text]
  62. Chandrasekher G, Ma X, Lallier TE, Bazan HE. Delay of corneal epithelial wound healing and induction of keratocyte apoptosis by platelet-activating factor. Invest Ophthalmol Vis Sci. 2002;43:1422–1428.[Abstract/Free Full Text]
  63. Midwood KS, Williams LV, Schwarzbauer JE. Tissue repair and the dynamics of the extracellular matrix. Int J Biochem Cell Biol. 2004;36:1031–1037.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  64. Zhao C, Meng A. Sp1-like transcription factors are regulators of embryonic development in vertebrates. Dev Growth Differ. 2005;47:201–211.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  65. Zaniolo K, Gingras ME, Audette M, Guerin SL. Expression of the gene encoding poly(ADP-ribose) polymerase-1 is modulated by fibronectin during corneal wound healing. Invest Ophthalmol Vis Sci. 2006;47:4199–4210.[Abstract/Free Full Text]
  66. Hasan NM, MacDonald MJ. Sp/Kruppel-like transcription factors are essential for the expression of mitochondrial glycerol phosphate dehydrogenase promoter B. Gene. 2002;296:221–234.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  67. Decline F, Okamoto O, Mallein-Gerin F, et al. Keratinocyte motility induced by TGF-beta1 is accompanied by dramatic changes in cellular interactions with laminin 5. Cell Motil Cytoskeleton. 2003;54:64–80.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  68. Allegra M, Gagnoux-Palacios L, Gache Y, et al. Rapid decay of alpha6 integrin caused by a mis-sense mutation in the propeller domain results in severe junctional epidermolysis bullosa with pyloric atresia. J Invest Dermatol. 2003;121:1336–1343.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  69. Borradori L, Sonnenberg A. Hemidesmosomes: roles in adhesion, signaling and human diseases. Curr Opin Cell Biol. 1996;8:647–656.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  70. Stepp MA, Spurr-Michaud S, Gipson IK. Integrins in the wounded and unwounded stratified squamous epithelium of the cornea. Invest Ophthalmol Vis Sci. 1993;34:1829–1844.[Abstract/Free Full Text]
  71. Gipson IK, Spurr-Michaud S, Tisdale A, Elwell J, Stepp MA. Redistribution of the hemidesmosome components alpha 6 beta 4 integrin and bullous pemphigoid antigens during epithelial wound healing. Exp Cell Res. 1993;207:86–98.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  72. Vigneault F, Zaniolo K, Gaudreault M, Gingras ME, Guerin SL. Control of integrin genes expression in the eye. Prog Retinal Eye Res. 2007;26:99–161.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  73. Grinstein E, Jundt F, Weinert I, Wernet P, Royer HD. Sp1 as G1 cell cycle phase specific transcription factor in epithelial cells. Oncogene. 2002;21:1485–1492.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  74. Laniel MA, Poirier GG, Guerin SL. Nuclear factor 1 interferes with Sp1 binding through a composite element on the rat poly(ADP-ribose) polymerase promoter to modulate its activity in vitro. J Biol Chem. 2001;276:20766–20773.[Abstract/Free Full Text]
  75. Nakamura M, Okura T, Kitami Y, Hiwada K. Nuclear factor 1 is a negative regulator of gadd153 gene expression in vascular smooth muscle cells. Hypertension. 2001;37:419–424.[Abstract/Free Full Text]
  76. Steffensen KR, Holter E, Tobin KA, et al. Members of the nuclear factor 1 family reduce the transcriptional potential of the nuclear receptor LXRalpha promoter. Biochem Biophys Res Commun. 2001;289:1262–1267.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  77. Gao B, Jiang L, Kunos G. Transcriptional regulation of alpha(1b) adrenergic receptors (alpha(1b)AR) by nuclear factor 1 (NF1): a decline in the concentration of NF1 correlates with the downregulation of alpha(1b)AR gene expression in regenerating liver. Mol Cell Biol. 1996;16:5997–6008.[Abstract]
  78. Clark RE, Jr, Miskimins WK, Miskimins R. Cyclic AMP inducibility of the myelin basic protein gene promoter requires the NF1 site. Int J Dev Neurosci. 2002;20:103–111.[Web of Science][Medline][Order article via Infotrieve]
  79. Rafty LA, Santiago FS, Khachigian LM. NF1/X represses PDGF A-chain transcription by interacting with Sp1 and antagonizing Sp1 occupancy of the promoter. EMBO J. 2002;21:334–343.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  80. Laniel MA, Bergeron MJ, Poirier GG, Guerin SL. A nuclear factor other than Sp1 binds the GC-rich promoter of the gene encoding rat poly(ADP-ribose) polymerase in vitro. Biochem Cell Biol. 1997;75:427–434.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  81. Ouellet S, Vigneault F, Lessard M, Leclerc S, Drouin R, Guérin SL. Transcriptional regulation of the cyclin-dependent kinase inhibitor 1A (p21) gene by NFI in proliferating human cells. Nucleic Acids Res. 2006;34:6472–6487.[Abstract/Free Full Text]
  82. Gounari F, De Francesco R, Schmitt J, van der Vliet P, Cortese R, Stunnenberg H. Amino-terminal domain of NF1 binds to DNA as a dimer and activates adenovirus DNA replication. EMBO J. 1990;9:559–566.[Web of Science][Medline][Order article via Infotrieve]
  83. Bachurski CJ, Kelly SE, Glasser SW, Currier TA. Nuclear factor I family members regulate the transcription of surfactant protein-C. J Biol Chem. 1997;272:32759–32766.[Abstract/Free Full Text]
  84. Hung CF, Penning TM. Members of the nuclear factor 1 transcription factor family regulate rat 3alpha-hydroxysteroid/dihydrodiol dehydrogenase (3alpha-HSD/DD AKR1C9) gene expression: a member of the aldo-keto reductase superfamily. Mol Endocrinol. 1999;13:1704–1717.[Abstract/Free Full Text]
  85. Majumder S, Ghoshal K, Gronostajski RM, Jacob ST. Downregulation of constitutive and heavy metal-induced metallothionein-I expression by nuclear factor I. Gene Expr. 2001;9:203–215.[Web of Science][Medline][Order article via Infotrieve]
  86. Araki K, Nakajima Y, Eto K, Ikeda MA. Distinct recruitment of E2F family members to specific E2F-binding sites mediates activation and repression of the E2F1 promoter. Oncogene. 2003;22:7632–7641.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  87. Tao Y, Kassatly RF, Cress WD, Horowitz JM. Subunit composition determines E2F DNA-binding site specificity. Mol Cell Biol. 1997;17:6994–7007.[Abstract]
  88. Bieda M, Xu X, Singer MA, Green R, Farnham PJ. Unbiased location analysis of E2F1-binding sites suggests a widespread role for E2F1 in the human genome. Genome Res. 2006;16:595–605.[Abstract/Free Full Text]
  89. Zheng N, Fraenkel E, Pabo CO, Pavletich NP. Structural basis of DNA recognition by the heterodimeric cell cycle transcription factor E2F-DP. Genes Dev. 1999;13:666–674.[Abstract/Free Full Text]
  90. Geuijen CA, Sonnenberg A. Dynamics of the {alpha}6ß4 integrin in keratinocytes. Mol Biol Cell. 2002;13:3845–3858.[Abstract/Free Full Text]
  91. Yuen HW, Ziober AF, Gopal P, et al. Suppression of laminin-5 expression leads to increased motility, tumorigenicity, and invasion. Exp Cell Res. 2005;309:198–210.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  92. Goldfinger LE, Stack MS, Jones JC. Processing of laminin-5 and its functional consequences: role of plasmin and tissue-type plasminogen activator. J Cell Biol. 1998;141:255–265.[Abstract/Free Full Text]
  93. Giannelli G, Falk-Marzillier J, Schiraldi O, Stetler-Stevenson WG, Quaranta V. Induction of cell migration by matrix metalloprotease-2 cleavage of laminin-5. Science. 1997;277:225–228.[Abstract/Free Full Text]
  94. Li F, Carlsson D, Lohmann C, et al. Cellular and nerve regeneration within a biosynthetic extracellular matrix for corneal transplantation. Proc Natl Acad Sci USA. 2003;100:15346–15351.[Abstract/Free Full Text]
  95. Sweeney DF, Xie RZ, Evans MD, et al. A comparison of biological coatings for the promotion of corneal epithelialization of synthetic surface in vivo. Invest Ophthalmol Vis Sci. 2003;44:3301–3309.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
IOVSHome page
M.-E. Gingras, B. Masson-Gadais, K. Zaniolo, S. Leclerc, R. Drouin, L. Germain, and S. L. Guerin
Differential Binding of the Transcription Factors Sp1, AP-1, and NFI to the Promoter of the Human {alpha}5 Integrin Gene Dictates Its Transcriptional Activity
Invest. Ophthalmol. Vis. Sci., January 1, 2009; 50(1): 57 - 67.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
M. Gaudreault, F. Vigneault, M.-E. Gingras, S. Leclerc, P. Carrier, L. Germain, and S. L. Guerin
Transcriptional Regulation of the Human {alpha}6 Integrin Gene by the Transcription Factor NFI during Corneal Wound Healing
Invest. Ophthalmol. Vis. Sci., September 1, 2008; 49(9): 3758 - 3767.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gaudreault, M.
Right arrow Articles by Guérin, S. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gaudreault, M.
Right arrow Articles by Guérin, S. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS