Originally published In Press as
doi:10.1167/iovs.07-1668 on July 9, 2008
(Investigative Ophthalmology and Visual Science. 2008;49:5215-5221.)
© 2008 by The Association for Research in Vision and Ophthalmology, Inc.
doi:10.1167/iovs.07-1668
Basic Fibroblast Growth Factor Impact on Retinoblastoma Progression and Survival
Colleen M. Cebulla,
Maria-Elena Jockovich,
Yolanda Piña,
Hinda Boutrid,
Armando Alegret,
Amy Kulak,
Abigail S. Hackam,
Sanjoy K. Bhattacharya,
William J. Feuer, and
Timothy G. Murray
From the Bascom Palmer Eye Institute, Department of Ophthalmology, University of Miami Miller School of Medicine, Miami, Florida.
 |
Abstract
|
|---|
PURPOSE. Chemotherapy resistance is a problem in the treatment of advanced retinoblastoma (RB). Since basic fibroblast growth factor (bFGF) is a survival factor for neural precursor cells, bFGF was evaluated as a growth and chemoresistance factor in RB.
METHODS. bFGF expression was analyzed in the LH-βTag transgenic mouse model of RB and human RB cell lines by immunofluorescence, RT-PCR, and Western blot. Proliferation and apoptosis (TUNEL) assays were performed.
RESULTS. bFGF levels significantly increased during tumorigenesis in transgenic RB, as a function of tumor status (P = 0.005). PCR and confocal microscopy confirmed that the human cell lines and primary tumors expressed bFGF. bFGF was localized to vascular and tumor cells and rarely to glial cells. Exogenous 18-kDa bFGF induced proliferation in two RB cell lines (WERI and Y79). Western blot analysis demonstrated 34-, 22-, and 18-kDa isoforms in transgenic RB and both cell lines. In TUNEL assays, chemoresistance to carboplatin-induced apoptosis was observed in the Y79 line, which expressed a higher ratio of high (34 kDa)- to low-molecular-weight bFGF isoforms, compared with the WERI line. Similar to other bFGF tumor studies, exogenous low-molecular-weight (18 kDa) bFGF (1 ng) significantly enhanced carboplatin-induced apoptosis in the more chemosensitive WERI, but not the chemoresistant Y79 line.
CONCLUSIONS. RB tumors produce significant amounts of bFGF, and the differential production and response to isoforms of bFGF may have implications for invasive tumor growth and chemoresistance.
Retinoblastoma (RB), a tumor of retinal origin, is a relatively common malignancy in childhood.1 2 Systemic chemotherapy, particularly with the platinum-based agent carboplatin, is integral to the therapeutic management of RB.3 4 5 6
Treatment failures in advanced cases have prompted evaluation of the mechanisms of drug resistance in RB. Upregulation of P-glycoprotein, an ATP-dependent plasma membrane pump that removes drugs from cancer cells, has been identified as a major resistance factor in RB.6 7 8
Growth factors are also known to promote tumor drug resistance.9 Fibroblast growth factors, especially basic fibroblast growth factor (bFGF/FGF-2), induce angiogenesis and regulate apoptosis.10 They appear to contribute to chemoresistance and more advanced disease grade in several types of tumor in humans.11 12 Murine models also suggest that bFGF influences cancer progression and chemoresistance. In mouse carcinoma models, stable transfection of tumor cells with 24-kDa bFGF increases metastatic disease, whereas tumor cells not expressing this bFGF isoform are more susceptible to apoptosis, decreasing metastases.13 14 Similarly, genetic or pharmacologic inhibition of bFGF decreases metastatic disease and reduces chemoresistance in several mouse cancer models.15 16 17
Of interest, in vitro studies of the effects of bFGF on tumor cell proliferation and chemotherapy-induced cell death, show that bFGF induces chemoresistance in some tumors (e.g., small cell lung cancer; SCLC),18 while inducing chemosensitization in others (e.g., primitive neuroectodermal tumors and Ewings sarcoma).19 20 These differences depend on the cell type, bFGF isoform, and delivery method of bFGF used. There are five bFGF isoforms, each with a different function. The isoforms, generated by alternative initiation of transcription, include an 18-kDa low-molecular-weight (LMW) form that may be secreted, as well as high-molecular-weight (HMW) isoforms at 22, 22.5, 24, and 34 kDa.21 22 23 In particular, the nuclear localization of these HMW isoforms has been associated with increased tumorigenicity and metastatic potential.14 The differential expression of these isoforms influence bFGF tumor-specific effects.22
Since bFGF has been proposed to be a survival and neurotrophic factor for neural precursor cells,24 we hypothesized that it could play a role in the progression and chemoresistance of RB tumors. bFGF and FGF receptor expression have been reported in RB25 26 27 ; however, the role of bFGF in tumorigenesis, tumor growth, and chemoresistance has not been explored. The purpose of this study was threefold: (1) to evaluate bFGF expression and localization in human RB and transgenic murine RB, particularly during tumorigenesis; (2) to determine whether exogenous bFGF promotes tumor proliferation and inhibits apoptosis; and (3) to determine whether there are differences in bFGF isoform expression between aggressive and indolent RB cell lines.
 |
Methods
|
|---|
Animals
The study protocol was approved by the University of Miami Animal Care and Use Committee and was conducted in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The LH-βTag transgenic murine retinoblastoma model has been characterized previously.28 These animals develop bilateral, heritable tumors, initiating in the inner nuclear layer, that increase progressively with age. Presence of SV40Tag was detected by PCR analysis of tail biopsies. Littermates negative for SV40Tag served as the negative control.
Cells and Media
Y79 and WERI human RB cell lines29 30 were grown at 37°C in RPMI-1640 medium with 10% fetal bovine serum (Hyclone, Logan, UT), penicillin (100 U/mL)/streptomycin(100 µg/mL), and 30 mg/L L-glutamine. Cells were maintained with feeding twice weekly. Serum was omitted in the proliferation and apoptosis studies.
Human Primary Tumors
Human tissue studies complied with the tenets of the Declaration of Helsinki and were conducted with University of Miami Institutional Review Board approval. Nine primary tumor samples were obtained from enucleations at the Bascom Palmer Eye Institute, from patients with RB, either without prior treatment or with posttreatment with systemic chemotherapy and focal laser. A portion of each tumor was frozen in OCT by the pathologist immediately after enucleation and serially sectioned (8 µm) for immunochemistry.
Reverse Transcription–PCR
Total RNA was isolated from WERI and Y79 cells with phenol-based extraction (Trizol; Invitrogen, Carlsbad, CA) per the manufacturers instructions. Reverse transcription for bFGF and β-actin was performed using standard procedures. Amplification was performed at the following temperatures: 94°C for 1 minute, 54°C for 1 minute, and 72°C for 1 minute, for a total of 30 cycles. Primers for bFGF (forward: tgctggtgatgggagttgta and reverse: ctgagtattcggcaacagca) generated a 181-bp product and β-actin (forward: aagatgacccaggtgagtgg and reverse: cctgcagagttccaaaggag) generated a 155-bp product.
Immunofluorescence
Mouse eyes were embedded in OCT, snap frozen in liquid nitrogen, and sectioned (8 µm). The slides were fixed with 4% paraformaldehyde at room temperature for 10 minutes and blocked with PBS containing 5% bovine serum albumin and 1% Triton X-100. bFGF was detected with a rabbit polyclonal antibody (AB1459; Chemicon, Temecula, CA) and an Alexa Fluor 488–conjugated secondary antibody (Invitrogen). Omission of the primary antibody was used as the control for background staining. Cell nuclei were counterstained with DAPI. Vascular endothelial cells were detected with Alexa Fluor 568–conjugated lectin (Bandeiraea simplicifolia; Invitrogen)31 and glial cells were detected with anti-glial fibrillary acidic protein (GFAP, monoclonal 131-17719; Invitrogen-Molecular Probes, Eugene, OR) followed by Alexa Fluor 568–conjugated goat anti-mouse secondary antibody (Invitrogen-Molecular Probes). Secondary antibodies were tested with each primary antibody, to ensure that no cross-reaction had occurred in the dual immunostaining experiments. WERI and Y79 cells, as well as frozen sections of human primary RB tumors (n = 9), were evaluated for bFGF expression, as just described. The eyes were evaluated by an ocular pathologist with H&E staining. The examination included evaluating necrosis, viable tumor, mitotic figures, tumor in association with retina or choroid, and types of rosettes. Serial cross-sections of cells or eyes containing tumors were examined with an upright fluorescence microscope (model BX51; Olympus America, Inc., Melville, NY) or confocal microscope (TCS SP5; Leica, Wetzlar, Germany). All images were digitally acquired and quantitated.
Quantitation of bFGF Immunostaining
Analyses were performed on digitized fluorescence microscopic images (x200) with image-analysis software (Photoshop CS; Adobe Systems, San Jose, CA), as previously described.31 Immunostaining intensities of bFGF in LH-βTag eyes were calculated as the average from at least four sections of at least four tumors per group. The bFGF density, calculated in pixels, was selected and measured as a fraction of tumor area. For controls, or images without tumors, bFGF staining inside the inner nuclear layer (INL)+ganglion cell layer (GCL) areas were measured. For confocal analyses, Z-stack images were taken, with 100 sections per image, to visualize the subcellular location of bFGF. Focal areas of bFGF immunostaining were quantitated as a percentage of bFGF-positive tumor.
Cell Proliferation Assays
WERI or Y79 cells were rinsed once with PBS and plated at 5 x 104 cells/well of a 96-well plate in a final volume of 200 µL of serum-free medium. Cells were incubated for 4 days with a range (0, 0.01, 0.1, 1, and 10 ng/mL) of 18 kDa recombinant bFGF (Chemicon), added at day 0. Cells (8–20 µm), with three to five replicates per condition, were counted with a particle counter (Beckman-Coulter, Fullerton, CA), to evaluate cell proliferation.
Chemotherapy-Induced Apoptosis Assays
WERI or Y79 cells were rinsed with PBS and plated at 6 x 104 cells/well of a 96-well plate, with three to four replicates per condition, in serum-free medium. Cells were treated with 50,000 ng/mL of freshly prepared carboplatin, carboplatin+bFGF (1 ng/mL), bFGF, or no additions for 20 hours (modified from Vandermoere et al.32 ). The amount of carboplatin needed to induce apoptosis was optimized in preliminary studies (not shown). TUNEL assays (ApopTag Fluorescein In Situ Apoptosis Detection Kit; Chemicon) were performed on paraformaldehyde-fixed cells according to the manufacturers instructions. Cell nuclei were stained with DAPI. The cells were evaluated in a masked fashion at 400x magnification using an upright fluorescence microscope (BX51; Olympus), and the percentage of apoptotic cells was determined at 400x magnification. A minimum of 500 cells and five high-power fields were counted per condition, with three replicates.
Western Blot
Y79 and WERI cells or LHβ-Tag retinas/tumors (n = 6–8 retinas per group) were lysed with cold extraction buffer (125 mM TrisCl [pH 7.0], 100 mM NaCl and 1% sodium dodecyl sulfate [SDS]) and homogenized. Proteins were quantitated using the Bradford method. Equal microgram quantities of protein were suspended in Laemmli buffer and fractionated with SDS-PAGE on 4% to 20% precast gels (Invitrogen). Proteins were electroblotted onto a polyvinylidene difluoride (PVDF) membrane (Bio-Rad; Hercules, CA). Membranes were blocked with 5% milk and incubated with bFGF primary antibody (AB1459; Chemicon) and a secondary antibody conjugated to horseradish peroxidase. Blots were developed by chemiluminescence. The blots were stripped, and β-actin was evaluated as a loading control to normalize the data.
Statistical Methods
Analysis of the intensity of bFGF from the immunofluorescence time-course experiment was determined by analysis of variance. For proliferation studies, second-order polynomial dose–response curves were fitted after square-root transforming cell counts and log transforming concentrations. Apoptosis experiments were analyzed by a test of interaction in two-factor analysis of variance. Results were considered statistically significant if P
0.05.
 |
Results
|
|---|
Expression of bFGF during Tumorigenesis in Murine RB
To determine the expression of bFGF during tumorigenesis, we performed a time-course immunofluorescence analysis of intraocular bFGF expression in LH-βTag-positive mice and background control mice at 4 weeks (preneoplastic stage, n = 4), 8 weeks (small tumor stage, n = 4), and 16 weeks (large tumor stage n = 4). The antibody recognizes all bFGF isoforms. bFGF density was significantly affected by both age (P = 0.032) and presence of the tumor (P = 0.005) by analysis of variance. Post hoc least significant difference tests determined that peak bFGF density was present in 8-week positive mice (Fig. 1A) . Density at 8 weeks was significantly greater than at 4 or 16 weeks (P = 0.0001 and 0.013, respectively), and the density at 16 weeks was greater than at 4 weeks (P = 0.053, Figs. 1BA-BC ). The pattern of bFGF in this study was primarily vascular at the preneoplastic stage (4 weeks), small tumor stage (8 weeks), and in very large tumors (16 weeks), as confirmed by costaining with the pan endothelial binding agent lectin (Figs. 1BD-BF) . Using GFAP as a marker, there was little colocalization of bFGF with glial cells (Figs. 1BG-BI) . The glial cells can be seen wrapping around the bFGF-positive vessels (Fig. 1BI , inset). Twelve-week-old animals (n = 4) with medium-sized tumors were also evaluated, and the bFGF staining was noted primarily in tumor cells (Fig. 1C) . Surprisingly, cells in the outer nuclear layer adjacent to these medium-sized tumors were also noted to have intense bFGF expression (Fig. 1C) .

View larger version (41K):
[in this window]
[in a new window]
|
FIGURE 1. bFGF was expressed during tumorigenesis in transgenic murine RB. (A) Immunofluorescence time-course analysis for intraocular bFGF in LH-βTag mice and controls at 4 (preneoplastic), 8 (small tumors), and 16 (large tumors) weeks. The elevation in bFGF levels is statistically significant in the tumors of older animals (8 weeks, P = 0.0001; 16 weeks, P = 0.013). Error bars, SD. (B) Confocal microscopy reveals a vascular pattern of bFGF (green) with very little expression in preneoplastic retina (BA) and extensive expression in large tumors (BB, BC) and small tumors (not shown). Co-immunostaining with bFGF (green, BD) and lectin (red, BE) confirmed the endothelial localization of bFGF (merge, yellow, BF). Blue: DAPI nuclear stain. There was little colocalization of bFGF (green) with GFAP (red), a glial marker (BG–BI). The glial cells can be seen wrapping around the bFGF-positive vessels (BI, inset). (C) Confocal analysis demonstrated that bFGF immunostaining (green, CB, CE) in medium-sized tumors was primarily in a focal pattern in tumor cells). The bFGF positive cells outlined by the white box in (CB) were evaluated with Z-stack confocal analysis. bFGF expression is both nuclear and extranuclear. Magnification: (BA, BB) x200; (BC–BI, CA–CC) x400; (CD–CF) x630.
|
|
The HMW forms of bFGF (e.g., 24 and 34 kDa), that are associated with tumor growth and survival, predominantly colocalize with the nucleus in transfection experiments.14 22 The subcellular localization of bFGF was analyzed in the medium-sized tumors by using confocal analysis to see whether bFGF expression was primarily nuclear or extranuclear. Our results showed bFGF staining was predominantly extranuclear, although some cells had prominent nuclear bFGF as well (Figs. 1CD-CF) .
bFGF Expression in Human RB
To confirm that human RB cells produce bFGF, we performed RT-PCR and immunofluorescence studies to evaluate the presence of bFGF messenger RNA and protein, respectively. RT-PCR for bFGF was performed in two human RB cell lines: WERI (indolent) and Y79 (aggressive).33 Both were positive for bFGF (Fig. 2A) . β-Actin was amplified as a positive control. Immunofluorescence analysis demonstrated that Y79 and WERI cells were positive for bFGF immunostaining (Fig. 2B) . The subcellular location of bFGF was extranuclear, sometimes in discrete perinuclear clusters (Fig. 2B , right). All nine human primary RB tumors evaluated were diffusely positive for bFGF immunostaining (Fig. 2C) . Seven of the nine tumors had focal clusters of strong bFGF positivity. Further evaluation with Z-stack analysis revealed that bFGF was positive in nuclear and extranuclear locations in cells (Figs. 2DA-DD) . In the tumor with the highest density of focal bFGF expression (RB209), these focal regions accounted for 0.06% of the area of the total tumor. Since some bFGF appeared to be in cells with spindle-shaped morphology, an evaluation of bFGF in glia was performed. Similar to the results in murine RB, GFAP-positive cells lined bFGF-positive vascular structures (Figs. 2DE-DH) ; however, more colocalization of bFGF with glia was observed in human RB than murine RB (Figs. 2DE-DL) . No correlation of bFGF expression was noted with RB treatment status (i.e., primary enucleation or chemotherapy plus laser).

View larger version (60K):
[in this window]
[in a new window]
|
FIGURE 2. bFGF was expressed in human RB. (A) RT-PCR of bFGF mRNA in WERI and Y79 RNA. Actin was amplified as an internal control. Blank lanes contained no cDNA: labels #1 and #2 represent separate RNA isolations. (B) Confocal microscopy analysis of bFGF immunostaining in WERI and Y79 cells. Merged images of bFGF (green), DAPI (blue), and Nomarski (gray) are shown. The expression of bFGF (green) was primarily in the plasma membrane and cytoplasm. Controls (secondary only) were negative (WERI control shown, B, left). (C) Confocal analysis of primary human RB tumors showed representative images of bFGF immunostaining in two tumors. Controls (secondary only) were negative, and DAPI (blue) was used as a counterstain. (D) As shown in the Z-stack composite image of primary tumor RB209, which had high bFGF levels, bFGF (green) is primarily extranuclear (white arrow) and sometimes colocalized with the nucleus (black arrow) of primary tumor cells. Moderate bFGF levels (green) were present in GFAP-positive cells (red), which wrapped around strongly bFGF-positive vascular structures (DE–DH). Some areas of focal bFGF expression colocalized with GFAP markers (DI–DL). The Z-stack image, including cross-sections, shows colocalization in one of these cells (yellow, arrow, DL). Magnification: (B) x400; (C) x200; (D) x630.
|
|
bFGF-Induced RB Proliferation
bFGF is a well-known mitogen for several cell types, and several studies document tumor cell proliferation in response to bFGF.34 Proliferation assays to determine RB growth responses to exogenous bFGF (0, 0.01, 0.1, 1, and 10 ng/mL) were performed with WERI and Y79 human RB cells by adding bFGF at day 0 and counting cells after 4 days with a particle counter (Beckman Coulter). Proliferation assays demonstrated significant, dose-dependent proliferation of Y79 and WERI cells in response to bFGF (P < 0.001 and P = 0.005, respectively). Y79 cells showed a higher proliferation rate than WERI cells in response to bFGF (P < 0.001, Wilcoxon test; Fig. 3 ).

View larger version (11K):
[in this window]
[in a new window]
|
FIGURE 3. Exogenous (18 kDa) bFGF induced RB cell proliferation. Proliferation assays to determine RB growth responses to exogenous bFGF (0, 0.01, 0.1, 1, and 10 ng/mL) were performed with WERI and Y79 human RB cells by counting cells after 4 days. Data points are averages of three to five wells per condition. Error bars, SD.
|
|
Exogenous 18-kDa bFGF-Induced Increase in Carboplatin-Induced Apoptosis
Conflicting reports exist in the literature regarding whether exogenous bFGF promotes or inhibits tumor cell apoptosis.10 Carboplatin, a platinum-based cytotoxic agent that induces cross-linking of DNA, is typically used to treat children with retinoblastoma.5 10 To evaluate whether exogenous (18 kDa) bFGF induces sensitization or resistance to carboplatin therapy, TUNEL assays were performed to evaluate apoptosis in WERI and Y79 RB cell lines in response to 20-hour carboplatin treatment. Of interest, WERI apoptosis levels were significantly enhanced by bFGF (1 ng/mL, P = 0.009), whereas no significant effect of bFGF was detected for Y79 apoptosis levels (Fig. 4) . Treatment with bFGF alone did not affect apoptosis levels in either cell type (data not shown). Y79 cells were also noted to be much more resistant to carboplatin-induced cell death than were WERI cells, consistent with their known, aggressive phenotype.

View larger version (12K):
[in this window]
[in a new window]
|
FIGURE 4. Exogenous bFGF induced increased carboplatin-induced apoptosis in WERI (indolent) but not Y79 (aggressive) cells. TUNEL assays were performed to evaluate apoptosis in WERI and Y79 cell lines in response to 20 hours of carboplatin treatment. WERI apoptosis was enhanced by bFGF (1 ng/mL), whereas no significant effect of bFGF was detected on Y79 apoptosis levels. Error bars, SD.
|
|
Differential Expression of bFGF Isoforms in RB
Five isoforms of bFGF have been identified with molecular weights of 18, 22, 22.5, 24, and 34 kDa. Tumor cells have been reported to make many different isoforms, particularly the HMW 24- and 34-kDa forms that may play significant roles in cell migration and prevention of apoptosis.22 To evaluate what isoforms are produced in RB, we performed Western blot analyses. The 34-, 22-, and 18-kDa isoforms of bFGF were detected in both Y79 and WERI lines. Of note, although overall levels of total bFGF were lower in the aggressive RB cell line (Y79) compared with the less aggressive line (WERI), the ratio of HMW (34 kDa) to LMW isoforms (18 and 22) was higher (Fig. 5A) .

View larger version (41K):
[in this window]
[in a new window]
|
FIGURE 5. Differential expression of bFGF isoforms in RB. (A) Western blot shows Y79 and WERI 34-, 22-, and 18-kDa isoforms of bFGF. The LMW were present at lower levels in the aggressive line (Y79) than in the less aggressive line (WERI). The 34-kDa isoform was present in the supernatant of both Y79 and WERI after 18 hours in serum-free conditions. Immunoblotting of β-actin was performed as a loading control and was present only in the cell isolates, not the supernatants (bottom blot). (B) Similar isoforms of 34, 22, and 18 kDa were present in LH-βTag mice and control animals at 4, 8, and 16, weeks of age. The bFGF levels were elevated in LH-βTag mice compared with the control. β-Actin was used as the loading control.
|
|
To characterize the bFGF isoforms secreted into the supernatant, which may act as paracrine growth and survival factors, we evaluated supernatants from Y79 and WERI cells grown overnight in serum-free conditions. Western blot analysis of these supernatants revealed that only the 34-kDa isoform was present in the supernatant of both Y79 and WERI. This finding was surprising, since this isoform, which acts as a survival factor, has two nuclear localization sequences and is not typically secreted.22 Arnaud et al.22 demonstrated that NIH3T3 cells transfected to express the 34-kDa isoform have approximately 60% bFGF expression in the nucleus and 40% in the cytoplasm by chloramphenicol acetyltransferase analysis. In contrast, cells transfected with the 18-kDa isoform had 80% cytoplasmic bFGF. Supernatants from these cells were not evaluated. Our data correspond with a report by Rubin et al.,35 showing a 38-kDa growth factor present in Y79 supernatants.
To determine whether murine bFGF expression is similar to that of human RB, we performed Western blot analyses of retinas isolated from LH-βTag mice and littermate control mice at 4, 8, and 12 weeks of age. Isoforms similar to those in human RB (approximately 18, 22, and 34 kDa) were present in these samples (Fig. 5B) . bFGF levels were increased, particularly the 34-kDa band, in the transgenic mice at 8 and 12 weeks, compared with positive 4-week transgenic mice and all negative littermate control animals.
 |
Discussion
|
|---|
Herein we show data suggesting the importance of bFGF in the pathobiology of retinoblastoma. We have confirmed that bFGF is expressed in human RB cell lines, primary tumors, and transgenic murine RB. Exogenous (18 kDa) bFGF induces proliferation in two RB cell lines, and induces chemosensitization in the less aggressive WERI line. Further, we show differences in isoform expression of bFGF. Both human and transgenic murine RB produce the 18-, 22-, and 34-kDa forms of bFGF. Of note, the more aggressive Y79 line had a higher ratio of the 34-kDa isoform to LMW forms, compared with the more indolent WERI line. The Y79 line was also more resistant to carboplatin-induced apoptosis than was the WERI line. Our findings are similar to other reports that the ratio of HMW to LMW forms of bFGF are increased in malignant cells compared with nontransformed cells.36 37 The 34-kDa isoform has been shown to be a powerful survival factor, and in one study, its transfection promoted cell survival under serum-free conditions better than other HMW bFGF forms.22 The increased ratio of 34-kDa bFGF in Y79 cells offers a potential explanation for the increased chemoresistance seen in this line.
The mechanism for bFGF chemosensitization in the WERI but not the Y79 cell line is not clear. The increase in cell proliferation alone is unlikely to be the reason for increased susceptibility to carboplatin-induced apoptosis, since the chemoresistant Y79 cells proliferated even more than the WERI cells in response to exogenous 18-kDa bFGF. This finding is consistent with that of Coleman et al.,34 who found that chemosensitization of a panel of tumor cells to cisplatin was not dependent on mitogenic activity. They did not induce sensitization with other growth-stimulatory factors, and the sensitizing effect of bFGF was observed in susceptible lines even without cell proliferation. Sensitization was not restricted to the S-phase of the cell cycle. They did find that platinum-based chemotherapy drugs, which induce DNA cross-linking, had the most prominent effect of sensitization from exogenous bFGF, compared to drugs with different mechanisms of action. The authors speculate that this effect may be explained by a relationship of bFGF to the type of DNA damage repair induced by platinum-based drugs.10
Another interesting finding in this study was that only the 34-kDa bFGF isoform was present in the conditioned media of Y79 and WERI cells under serum-free conditions. This finding is surprising, since only the 18-kDa isoform is widely reported to be secreted.22 However, HMW isoforms have been shown to be exported in some conditions.38 Previously, a 38-kDa secreted growth factor was identified in conditioned medium from Y79 cells growing for long periods in serum free conditions.35 Later, this was speculated to be a form of bFGF, as bFGF mRNA and bFGF-like activity (blockable with bFGF antibody) were detected in Y79 cell extracts.25
The mechanism of HMW bFGF isoform export is unknown. Our confocal microscopy analysis showed that the nuclear localization of bFGF immunostaining was in a minority of cells, in both human and transgenic murine RB, even though a previous report by Arnaud et al.22 showed 60% nuclear staining in fibroblast cells transfected with the 34-kDa isoform. The predominant cytoplasmic and plasma membrane localization of bFGF in RB tumor cells and the 34-kDa bFGF expression in the cell medium could suggest that a functional or physical alteration in the nuclear localization sequence (e.g., cleavage) occurs in RB tumor cells, which then enables this form of bFGF to act as a paracrine factor. Further studies are needed to explore the mechanism of release and functions of the 34-kDa bFGF in RB cells.
These data also suggest that bFGF may help mediate the angiogenic response of RB tumors. In transgenic murine RB, bFGF is upregulated during tumorigenesis, peaking when early tumors form (8 weeks). This finding supports the existence of an "angiogenic switch" in which a proangiogenic pattern of gene expression occurs, preceding spread of malignancy.39 RB generates a very robust angiogenic response,40 41 42 43 44 and bFGF is probably a major underlying angiogenic factor. In our study, bFGF was also found in a vascular pattern in transgenic murine RB. This suggests that bFGF in the tumor microenvironment plays a direct role in supporting vessel development. In addition to bFGF, VEGF is known to be produced in retinoblastoma.42 Of the VEGF receptors, VEGFR-2 is considered most important in mediating tumor angiogenesis.45 We have recently shown that, similar to bFGF, VEGFR-2 is upregulated and phosphorylated in transgenic murine retinoblastoma during tumorigenesis.46 In this model, although VEGFR-2 colocalizes with both endothelial cells and glia, it colocalizes more with glia; in contrast, bFGF localizes more to the tumor vasculature. Future studies with combined therapy targeting both VEGF and bFGF pathways may yield promising results, especially since bFGF-induced angiogenesis is partly dependent on the activation of VEGF in some in vitro and in vivo models.47
In conclusion, these data show that bFGF probably plays a role in RB tumorigenesis, proliferation, and chemoresistance. Future studies are needed to evaluate whether exploiting bFGF pathways in RB could lead to future therapeutic targets for this disease.
 |
Acknowledgements
|
|---|
The authors thank Magda Celdran for histology and Gabe Gaidosh for confocal microscopy assistance.
 |
Footnotes
|
|---|
Supported by National Eye Institute Grants R01 EY013629, R01 EY12651, and P30 EY014801.
Submitted for publication December 28, 2007; revised March 14 and June 24, 2008; accepted September 19, 2008.
Disclosure: C.M. Cebulla, None; M.-E. Jockovich, None; Y. Piña, None; H. Boutrid, None; A. Alegret, None; A. Kulak, None; A.S. Hackam, None; S.K. Bhattacharya, None; W.J. Feuer, None; T.G. Murray, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: Timothy G. Murray, Bascom Palmer Eye Institute, P.O. Box 016880, Miami, FL 33101; tmurray{at}med.miami.edu.
 |
References
|
|---|
- Tamboli A, Podgor MJ, Horm JW. The incidence of retinoblastoma in the United States: 1974 through 1985. Arch Ophthalmol. 1990;108:128–132.[Abstract/Free Full Text]
- Pendergrass TW, Davis S. Incidence of retinoblastoma in the United States. Arch Ophthalmol. 1980;98:1204–1210.[Abstract/Free Full Text]
- Sussman DA, Escalona-Benz E, Benz MS, et al. Comparison of retinoblastoma reduction for chemotherapy vs external beam radiotherapy. Arch Ophthalmol. 2003;121:979–984.[Abstract/Free Full Text]
- Gallie BL, Budning A, DeBoer G, et al. Chemotherapy with focal therapy can cure intraocular retinoblastoma without radiotherapy. Arch Ophthalmol. 1996;114:1321–1328.[Abstract/Free Full Text]
- Shields CL, Shields JA. Diagnosis and management of retinoblastoma. Cancer Control. 2004;11:317–327.[Medline][Order article via Infotrieve]
- Chan , Gallie , Munier , Beck P. Chemotherapy for retinoblastoma. Ophthalmol Clin. 2005;18:55–63.
- Chan HS, Canton MD, Gallie BL. Chemosensitivity and multidrug resistance to antineoplastic drugs in retinoblastoma cell lines. Anticancer Res. 1989;9:469–474.[Web of Science][Medline][Order article via Infotrieve]
- Chan HS, Thorner PS, Haddad G, Gallie BL. Multidrug-resistant phenotype in retinoblastoma correlates with P-glycoprotein expression. Ophthalmology. 1991;98:1425–1431.[Web of Science][Medline][Order article via Infotrieve]
- Zunyan D, Ying H, Sadee W. Growth factor signaling and resistance to cancer chemotherapy. Curr Topic Med Chem. 2004;4:1345–1354.
- Coleman AB. Positive and negative regulation of cellular sensitivity to anti-cancer drugs by FGF-2. Drug Resist Updat. 2003;6:85–94.[CrossRef][Medline][Order article via Infotrieve]
- Song S, Wientjes MG, Gan Y, Au JL. Fibroblast growth factors: an epigenetic mechanism of broad spectrum resistance to anticancer drugs. Proc Natl Acad Sci U S A. 2000;97:8658–8663.[Abstract/Free Full Text]
- Gan Y, Wientjes MG, Au JL. Expression of basic fibroblast growth factor correlates with resistance to paclitaxel in human patient tumors. Pharm Res. 2006;23:1324–1331.[CrossRef][Medline][Order article via Infotrieve]
- Thomas-Mudge RJ, Okada-Ban M, Vandenbroucke F, et al. Nuclear FGF-2 facilitates cell survival in vitro and during establishment of metastases. Oncogene. 2004;23:4771–4779.[CrossRef][Medline][Order article via Infotrieve]
- Okada-Ban M, Moens G, Thiery JP, Jouanneau J. Nuclear 24 kD fibroblast growth factor (FGF)-2 confers metastatic properties on rat bladder carcinoma cells. Oncogene. 1999;18:6719–6724.[CrossRef][Medline][Order article via Infotrieve]
- Polnaszek N, Kwabi-Addo B, Peterson LE, et al. Fibroblast growth factor 2 promotes tumor progression in an autochthonous mouse model of prostate cancer. Cancer Res. 2003;63:5754–5760.[Abstract/Free Full Text]
- Song S, Wientjes MG, Walsh C, Au JL. Nontoxic doses of suramin enhance activity of paclitaxel against lung metastases. Cancer Res. 2001;61:6145–6150.[Abstract/Free Full Text]
- Zhang Y, Song S, Yang F, Au JL, Wientjes MG. Nontoxic doses of suramin enhance activity of doxorubicin in prostate tumors. J Pharmacol Exp Therap. 2001;299:426–433.[Abstract/Free Full Text]
- Pardo OE, Arcaro A, Salerno G, Raguz S, Downward J, Seckl MJ. Fibroblast growth factor-2 induces translational regulation of Bcl-XL and Bcl-2 via a MEK-dependent pathway: correlation with resistance to etoposide-induced apoptosis. J Biol Chem. 2002;277:12040–12046.[Abstract/Free Full Text]
- Kim MS, Kim CJ, Jung HS, et al. Fibroblast growth factor 2 induces differentiation and apoptosis of Askin tumour cells. J Pathol. 2004;202:103–112.[CrossRef][Medline][Order article via Infotrieve]
- Jung HS, Kim HS, Lee MJ, et al. Arsenic trioxide concentration determines the fate of Ewings sarcoma family tumors and neuroblastoma cells in vitro. FEBS Lett. 2006;580:4969–4975.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Moscatelli D, Joseph-Silverstein J, Presta M, Rifkin DB. Multiple forms of an angiogenesis factor: basic fibroblast growth factor. Biochimie (Paris). 1988;70:83–87.
- Arnaud E, Touriol C, Boutonnet C, et al. A new 34-kilodalton isoform of human fibroblast growth factor 2 is cap dependently synthesized by using a non-AUG start codon and behaves as a survival factor. Mol Cell Biol. 1999;19:505–514.[Abstract/Free Full Text]
- Touriol C, Bornes S, Bonnal S, et al. Generation of protein isoform diversity by alternative initiation of translation at non-AUG codons. Biol Cell. 2003;95:169–178.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Hajihosseini MK, Dickson C. A subset of fibroblast growth factors (Fgfs) promote survival, but Fgf-8b specifically promotes astroglial differentiation of rat cortical precursor cells. Mol Cell Neurosci. 1999;14:468–485.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Schweigerer L, Neufeld G, Gospodarowicz D. Basic fibroblast growth factor is present in cultured human retinoblastoma cells. Invest Ophthalmol Vis Sci. 1987;28:1838–1843.[Abstract/Free Full Text]
- Kondo Y, Tanaka Y, Shields JA, Kondo S. Association between telomerase activity and basic fibroblast growth factor up-regulation in retinoblastomas. Anticancer Res. 2001;21:3765–3772.[Medline][Order article via Infotrieve]
- Siffroi-Fernandez S, Cinaroglu A, Fuhrmann-Panfalone V, et al. Acidic fibroblast growth factor (FGF-1) and FGF receptor 1 signaling in human Y79 retinoblastoma. Arch Ophthalmol. 2005;123:368–376.[Abstract/Free Full Text]
- Windle JJ, Albert DM, O'Brien JM, et al. Retinoblastoma in transgenic mice. Nature. 1990;343:665–669.[CrossRef][Medline][Order article via Infotrieve]
- Reid TW, Albert DM, Rabson AS, et al. Characteristics of an established cell line of retinoblastoma. J Natl Cancer Inst. 1974;53:347–360.[Web of Science][Medline][Order article via Infotrieve]
- McFall RC, Sery TW, Makadon M. Characterization of a new continuous cell line derived from a human retinoblastoma. Cancer Res. 1977;37:1003–1010.[Abstract/Free Full Text]
- Jockovich M-E, Bajenaru ML, Pina Y, et al. Retinoblastoma tumor vessel maturation impacts efficacy of vessel targeting in the LHBETATAG mouse model. Invest Ophthalmol Vis Sci. 2007;48:2476–2482.[Abstract/Free Full Text]
- Vandermoere F, El Yazidi-Belkoura I, Adriaenssens E, Lemoine J, Hondermarck H. The antiapoptotic effect of fibroblast growth factor-2 is mediated through nuclear factor-kappaB activation induced via interaction between Akt and IkappaB kinase-beta in breast cancer cells. Oncogene. 2005;24:5482–5491.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Chevez-Barrios P, Hurwitz MY, Louie K, et al. Metastatic and nonmetastatic models of retinoblastoma. Am J Pathol. 2000;157:1405–1412.[Abstract/Free Full Text]
- Coleman AB, Metz MZ, Donohue CA, Schwarz RE, Kane SE. Chemosensitization by fibroblast growth factor-2 is not dependent upon proliferation, S-phase accumulation, or p53 status. Biochem Pharmacol. 2002;64:1111–1123.[CrossRef][Medline][Order article via Infotrieve]
- Rubin NA, Tarsio JF, Borthwick AC, Gregerson DS, Reid TW. Identification and characterization of a growth factor secreted by an established cell line of human retinoblastoma maintained in serum-free medium. Vision Res. 1981;21:105–112.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Kevil C, Carter P, Hu B, DeBenedetti A. Translational enhancement of FGF-2 by eIF-4 factors, and alternate utilization of CUG and AUG codons for translation initiation. Oncogene. 1995;11:2339–2348.[Web of Science][Medline][Order article via Infotrieve]
- Vagner S, Touriol C, Galy B, et al. Translation of CUG- but not AUG-initiated forms of human fibroblast growth factor 2 is activated in transformed and stressed cells. J Cell Biol. 1996;135:1391–1402.[Abstract/Free Full Text]
- Piotrowicz RS, Martin JL, Dillman WH, Levin EG. The 27-kDa heat shock protein facilitates basic fibroblast growth factor release from endothelial cells. J Biol Chem. 1997;272:7042–7047.[Abstract/Free Full Text]
- Hanahan D, Folkman J. Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell. 1996;86:353–364.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Tapper D, Langer R, Bellows AR, Folkman J. Angiogenesis capacity as a diagnostic marker for human eye tumors. Surgery. 1979;86:36–40.[Web of Science][Medline][Order article via Infotrieve]
- Pe'er J, Neufeld M, Baras M, Gnessin H, Itin A, Keshet E. Rubeosis iridis in retinoblastoma: histologic findings and the possible role of vascular endothelial growth factor in its induction. Ophthalmology. 1997;104:1251–1258.[Web of Science]
- Stitt AW, Simpson DA, Boocock C, Gardiner TA, Murphy GM, Archer DB. Expression of vascular endothelial growth factor (VEGF) and its receptors is regulated in eyes with intra-ocular tumours. J Pathol. 1998;186:306–312.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Marback EF, Arias VE, Paranhos A, Jr, Soares FA, Murphree AL, Erwenne CM. Tumour angiogenesis as a prognostic factor for disease dissemination in retinoblastoma. Br J Ophthalmol. 2003;87:1224–1228.[Abstract/Free Full Text]
- Rossler J, Dietrich T, Pavlakovic H, et al. Higher vessel densities in retinoblastoma with local invasive growth and metastasis. Am J Pathol. 2004;164:391–394.[Abstract/Free Full Text]
- Prewett M, Huber J, Li Y, et al. Antivascular endothelial growth factor receptor (fetal liver kinase 1) monoclonal antibody inhibits tumor angiogenesis and growth of several mouse and human tumors. Cancer Res. 1999;59:5209–5218.[Abstract/Free Full Text]
- Cebulla CM, Jockovich ME, Boutrid H, et al. Lack of effect of SU1498, an inhibitor of vascular endothelial growth factor receptor-2, in a transgenic murine model of retinoblastoma. Open Ophthalmol J. 2008;2:62–67.[CrossRef]
- Tille JC, Wood J, Mandriota SJ, et al. Vascular endothelial growth factor (VEGF) receptor-2 antagonists inhibit VEGF- and basic fibroblast growth factor-induced angiogenesis in vivo and in vitro. J Pharm Exp Therap. 2001;299:1073–1085.[Abstract/Free Full Text]