IOVS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1167/iovs.08-1711 on August 1, 2008
(Investigative Ophthalmology and Visual Science. 2008;49:5629-5635.)
© 2008 by The Association for Research in Vision and Ophthalmology, Inc.
doi:10.1167/iovs.08-1711

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
iovs.08-1711v1
49/12/5629    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oishi, A.
Right arrow Articles by Yoshimura, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oishi, A.
Right arrow Articles by Yoshimura, N.

Granulocyte Colony-Stimulating Factor Protects Retinal Photoreceptor Cells against Light-Induced Damage

Akio Oishi, Atsushi Otani, Manabu Sasahara, Hiroshi Kojima, Hajime Nakamura, Yuko Yodoi, and Nagahisa Yoshimura

From the Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, Kyoto, Japan.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. Granulocyte colony stimulating factor (G-CSF) has been shown to have neuroprotective and anti-inflammatory effects in cerebral damage models. In addition, bone-marrow–derived hematopoietic cells, which can be mobilized with G-CSF, have a neuroprotective effect in hereditary retinal cell death. The present study was conducted to investigate whether G-CSF protects photoreceptors from light-induced cell death.

METHODS. G-CSF or vehicle was systemically injected before the light exposure and for four consecutive days after the exposure. Morphologic and electrophysiologic examinations were performed 1 week after the exposure to light. Gamma ray irradiation (6.5 Gy) was used to examine the involvement of bone marrow-derived cells increased by G-CSF injection. The expression of G-CSF receptor in the retina was analyzed by immunohistochemistry and quantitative RT-PCR.

RESULTS. The outer nuclear layer thickness was partially preserved in G-CSF–treated mice (measured at 300 µm superior from the optic disc, G-CSF: 14.9 ± 6.3 µm versus control: 6.7 ± 2.5 µm), and an electroretinogram confirmed the preservation of wave amplitudes (maximum scotopic a-wave G-CSF: 97.7 ± 48.0 µV versus control: 14.4 ± 21.9 µV, maximum scotopic b-wave G-CSF: 298.1 ± 145.3 µV versus control: 33.2 ± 50.1 µV). The effect was not lost, even with leukocyte depletion by irradiation. G-CSF receptor was expressed in retinal cells and upregulated by the light exposure (1.8-fold upregulation 2 hours after light exposure).

CONCLUSIONS. G-CSF protects photoreceptor cells against light-induced damage, possibly via G-CSF receptor expressed on retinal cells. These findings may lead to a novel treatment strategy for neural degenerating diseases of the retina.


Retinal diseases characterized by photoreceptor cell death, such as retinitis pigmentosa and age-related macular degeneration, are the leading causes of blindness in developed countries. The light-induced retinal damage model is used to study the mechanisms and treatment strategies for these diseases, since the model shares the pathologic feature of photoreceptor cell death. The main pathway of light-induced photoreceptor cell death is apoptosis.1 The causative mechanisms of the apoptosis include activation of nitric oxide synthase, calcium overload, disturbance of mitochondrial function, and generation of reactive oxygen species. A multitude of treatment strategies (e.g., inhibition of nitric oxide synthase, use of calcium channel blocker, modulating mitochondria, or administration of antioxidants) have been performed in animal models and found to mediate beneficial effects.2

Granulocyte colony-stimulating factor (G-CSF) is a potent and specific growth factor for neutrophilic granulocytes. It is commercially available and used in the treatment of neutropenia. It increases granulocytes by promoting the differentiation of granulocyte precursors3 and reducing apoptosis.4 In addition to these hematopoietic effects, antiapoptotic and neuroprotective effects of G-CSF were identified in models for cerebral ischemia5 6 7 8 9 and Parkinson’s disease.10 In fact, a preliminary clinical trial investigating the effect of G-CSF for stroke patients has showed favorable results.11 The antiapoptotic effect seems to be directly mediated via the G-CSF receptor (G-CSFR) expressed on neural cells.12

G-CSF also has an anti-inflammatory effect, which is beneficial for central nervous system injury. The administration of G-CSF to an animal model after intracerebral hemorrhage reduced brain edema, inflammation, and blood–brain barrier permeability.13 The effect was also seen in a stroke model8 14 and in experimental encephalomyelitis.15 The administration of G-CSF alters the expression level of several cytokines including IL-4, TGF-β1, interferon-{gamma}, TNF-{alpha}, IL-1β, and inducible nitric oxide synthase (iNOS).16 The regulation of these cytokines and subsequent reduction of T-cell migration to the injury site is considered to be a main factor in the anti-inflammatory effect.

In addition, G-CSF mobilizes hematopoietic stem cells from bone marrow into peripheral blood.17 The bone marrow–derived stem cells participate in angiogenesis in the retina.18 Intravitreous injection of these cells provides a neuroprotective effect in the model of retinitis pigmentosa through angiogenesis.19 A recent study even suggested the potential of these cells to differentiate into neural cells,20 and some reports have supported this notion in the recovering process of injured retina.21 22

We hypothesized that the neuroprotective and anti-inflammatory effects seen in the cerebral model could be beneficial for the retina as well as in the central nervous system. In addition, G-CSF-mobilized hematopoietic stem cells can possibly contribute to the protection or regeneration of injured retina. We examined whether G-CSF exhibits neuroprotective/antiapoptotic effects in a light-induced retinal damage model to investigate the potential of G-CSF treatment for retinal disease with photoreceptor loss.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Animals were treated according to the regulations in the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and the Guideline for Animal Experiments of Kyoto University. All animal experiments were conducted with the approval of the Animal Research Committee, Graduate School of Medicine, Kyoto University. The BALB/c mice used in all experiments were purchased from Nihon SLC (Shizuoka, Japan).

Light Damage
BALB/c albino mice were housed in 12-hour light–dark cycle conditions with a daytime light intensity of 12 lux. After the overnight dark adaptation, 6-week-old male mice were SC injected with vehicle or recombinant human G-CSF (Kirin, Tokyo, Japan) at a concentration of 100 or 10 µg/kg and were exposed to 5000 lux cool white fluorescent light (PL36W; Aqua System, Tokyo, Japan) for 2 hours. The light exposure was started at 10 AM. The temperature in the cage was checked and did not exceed 27°C. The mice were again housed under a 12-hour light–dark cycle. The daily injection of G-CSF or vehicle continued for the following 4 days.

Irradiation
To examine the effect of activated bone marrow-derived cells by G-CSF treatment, the mice were irradiated using {gamma}-ray (Nordion, Ottawa, Ontario, Canada) 5 days before light exposure. The total irradiated dose was 6.5 Gy, and the dose rate was 1.11 Gy/min. Hematologic parameters including erythrocyte, leukocyte, and platelet counts were determined with a particle counter (PCE 170; Erma Inc., Tokyo, Japan) in a preliminary experiment to confirm the effect of G-CSF and irradiation.

Electroretinogram
Seven days after exposure to light, ERGs of the mice were recorded. After overnight dark adaptation, the mice were anesthetized with intraperitoneal injection of ketamine (50 mg/kg) and xylazine (20 mg/kg). The pupils were fully dilated with 1% tropicamide, 2.5% phenylephrine HCl, and 1% cyclopentolate HCl (Santen Pharmaceutical, Osaka, Japan). During the ERG recording, the mice were kept on a heating pad to maintain a constant body temperature. ERGs were recorded (PowerLab System 2/25; AD Instruments, Nagoya, Japan), by using a gold wire loop placed on the right cornea. Reference electrodes were placed in the cheek, and the ground leads were placed on the hip.

Full-field scotopic ERGs were measured in response to 3-ms flashes at an intensity ranging from 0.329 to 30 cd-s/m2 at 1-minute intervals without averaging multiple responses. Subsequently, photopic ERGs were recorded in response to 0.329 to 30 cd-s/m2 flash and 30 cd/m2 background light after 7 minutes of light adaptation, filtered between 0.3 and 500 Hz, and stored. Thirty-two ERG measurements were obtained and averaged.

For the statistical analysis, we used scotopic ERGs recorded at intensities of 0.0127, 0.3279, 3.288, and 30 cd-s/m2, and photopic ERGs recorded at 3.288 and 30 cd-s/m2. The amplitudes of a-waves were measured from the baseline to the trough in the cornea-negative direction; b-waves were measured from the cornea-negative peak to the major cornea-positive trough. Photopic peak responses were measured from the baseline to the maximum cornea-positive peak. These analyses were performed with commercial software (Scope 3 ver. 3.8.2 software; AD Instruments).

Histologic Analysis
After recording the ERGs, the mice were transcardially perfused with 4% paraformaldehyde (Wako, Osaka, Japan) and 0.25% glutaraldehyde (Wako). A marking suture was placed on the upper conjunctiva, and the eyes were enucleated, fixed with the same solution, and embedded in paraffin. Then, 2-µm-thick vertical sections were made through the optic disc. These specimens were stained with hematoxylin and eosin and then photographed with a microscope (Axio Imager; Carl Zeiss Meditec, Jena, Germany). The outer nuclear layer (ONL) thickness was measured at the superior and inferior retina 150, 300, and 600 µm from the optic disc. The analysis was performed with the microscope system software (Axiovision ver. 4.3 software; Carl Zeiss Meditec). Measurements from both eyes were averaged as one sample for the statistical analysis.

For immunostaining, the eyes were enucleated from mice without light exposure. The eyes were fixed, sequentially immersed with 10%, 20%, and 30% sucrose, and then embedded in OCT compound (Miles, Elkhart, IN). Cryostat sections (5 µm thick) were mounted on silanized slides (Dako, Glostrup, Denmark). They were incubated at room temperature for 1 hour with 20% blocking solution (Block Ace; Dainihon-Seiyaku, Osaka, Japan) in 0.1 M PBS containing 0.03% Triton-X (Sigma-Aldrich, St. Louis, MO) to block nonspecific antibody binding. Specimens were incubated for 24 hours at 4°C with primary antibody diluted in 5% blocking solution in 0.1 M PBS. The following primary antibodies were used: rabbit anti–G-CSF (1:500; Santa Cruz Biotechnology, Santa Cruz, CA), rabbit anti–G-CSFR (1:500; Santa Cruz Biotechnology), mouse anti-rod opsin (1:5000; Sigma-Aldrich), mouse anti-calbindin (1:1000; Sigma-Aldrich), mouse anti-glutamine synthetase (1:1000; Chemicon, Temecula, CA), mouse anti-neurofilament M (1:1000; Chemicon). The secondary antibodies were anti-mouse IgG conjugated with Alexa 488 and anti-rabbit IgG conjugated with Alexa 546 (1:500, Invitrogen, Carlsbad, CA). Cell nuclei were counterstained with 4',6-diamidino-2-phenylindole (1 µg/mL; Invitrogen). For negative controls, the isotype control of rabbit IgG (1:100; Abcam, Tokyo, Japan) was used as the primary antibody. The specimens were imaged with a laser-scanning confocal microscope (LSM 5 Pascal; Carl Zeiss Meditec).

Reverse Transcription–Polymerase Chain Reaction
Retinas were collected from mice without light exposure or 2, 6, or 24 hours after light exposure. Total RNA was isolated (RNeasy; Qiagen, Hilden, Germany), treated with RNase-free DNase I, and reverse transcribed with a first-strand cDNA synthesis kit (GE Healthcare, Buckinghamshire, UK), according to the manufacturers’ protocols. cDNA from bone marrow was obtained and used as the positive control. The expression of G-CSFR was confirmed with conventional PCR using the following primers: G-CSFR (csf3r, accession number: NM_007782.2) forward TGTGCCCCAACCTCCAAACCA and reverse GCTAGGGGCCAGAGACAGAGACAC. Amplification was performed for 30 cycles. One cycle was 30 seconds at 95°C, 30 seconds at 60°C, and 40 seconds at 72°C. The PCR products were analyzed with 2% agarose gel electrophoresis. Quantitative real-time PCR was performed with a sequence detection system (Prism 7000; Applied Biosystems, Inc. [ABI] Foster City, CA). Reactions were performed in duplicate with SYBR Green PCR master mix (ABI). PCR probes for G-CSFR and intrinsic control β-actin were purchased from ABI. Cycling conditions were as follows: 10 minutes at 95°C, 15 seconds at 95°C, and 1 minute at 60°C for 40 cycles. Amplification plots and cycle threshold values from the exponential phase of the PCR were analyzed (Prism SDS 1.7; ABI). Relative regulation levels were determined after normalization to β-actin.

Statistical Analysis
Statistical analysis was performed with commercial software (SPSS, Chicago, IL). Data from each group were compared by one-way ANOVA followed by the Bonferroni test or unpaired t-test, as appropriate.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The administration of G-CSF efficiently increased the number of leukocytes: baseline, 3.0 ± 0.7 x 103/µL (n = 9); 10 µg/kg G-CSF for 5 days, 3.8 ± 1.2 x 103/µL (n = 8, P = 0.15 compared to base line); 100 µg/kg G-CSF for 5 days, 6.0 ± 3.0 x 103/µL (n = 9, P < 0.01). The number of erythrocytes and platelets was not significantly changed. An almost total depletion of leukocytes was confirmed 5 days after irradiation: 0.1 ± 0.1 x 103/µL (n = 5, P = 0.01). The number of leukocytes did not recover, even after 5 days of G-CSF injection after irradiation: 12 days after irradiation, 0.1 ± 0.1 x 103/µL (n = 5, P = 0.01). These results confirm that the G-CSF injection and irradiation worked well at the settings used.

Light exposure–induced photoreceptor cell death occurred as previously reported. ONL and photoreceptor outer segments (OS) were markedly thinned and disorganized. The damage was more severe in the superior or central retina than in the inferior or peripheral retina. Although injection of vehicle did not show a significant effect on cell death and retinal thinning, ONL and OS were partially preserved in the mice treated with G-CSF (Fig. 1A) . Thickness measurement of the ONL confirmed the statistically significant difference (Fig. 1B) . These results indicate that G-CSF decreased photoreceptor cell loss, at least at the morphologic level.


Figure 1
View larger version (29K):
[in this window]
[in a new window]

 
FIGURE 1. (A) Photographs of mouse retina. Left: untreated control mouse; middle: G-CSF–treated mouse; right: vehicle-treated mouse. (B) ONL retinal thickness. G-CSF–treated mice had thicker ONL than did vehicle-treated mice.

 
We used an electrophysiologic method, ERG, to determine whether there is a functional preservation. In normal mice, photopic and scotopic ERG responses increased with increasing light intensities (Fig. 2A , left). In contrast to the markedly decreased response in vehicle-treated mice (Fig. 2A , right), G-CSF–treated mice showed significantly preserved responses (Fig. 2A , middle). The amplitudes of scotopic a-waves, b-waves, and photopic responses were determined and compared, demonstrating a statistically significant difference between vehicle-treated and G-CSF–treated mice (Fig. 2B) . The result confirms the preservation of photoreceptor function as well as the photoreceptor structure. Although there was no statistically significant difference, injection of 100 µg/kg G-CSF seemed to be more effective than 10 µg/kg G-CSF. Therefore, we used a dose of 100 µg/kg in the remaining experiments.


Figure 2
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 2. (A) Representative results of scotopic and photopic ERG measured 1 week after light exposure. Left: normal untreated mouse; middle: G-CSF–treated mouse; right: vehicle-treated mouse. (B) Quantitative results of each component of scotopic and photopic ERGs. ERG amplitudes were retained in G-CSF–treated mice to a greater extent than in vehicle-treated mice.

 
Next, we examined whether bone marrow-derived cells increased by G-CSF played a role in photoreceptor cell preservation. As already mentioned, peripheral leukocytes were almost totally depleted with 6.5 Gy of irradiation and did not recover by the time of enucleation. We used these irradiated mice to determine the involvement of bone marrow–derived cells. After the irradiation, G-CSF–treated mice still showed a photoreceptor protective effect compared with vehicle-treated mice (Fig. 3A) . Functional protection, as determined by ERGs, was also observed in the G-CSF–treated condition (Fig. 3B) . These results suggest that G-CSF neuroprotective effects may be mediated directly via retinal cells rather than indirectly via leukocytes.


Figure 3
View larger version (22K):
[in this window]
[in a new window]

 
FIGURE 3. ONL thickness (A) and ERG amplitudes (B) of mice 1 week after light exposure. Leukocytes were depleted by irradiation 5 days before the light exposure. The G-CSF–treated mice exhibited better preservation of ONL both morphologically and electrophysiologically.

 
Since our data suggested that G-CSF works directly on retinal cells, we examined whether G-CSFR was expressed in retinal cells. Immunohistochemical analysis revealed that G-CSFR was universally expressed in retinal cells. Double staining showed that ganglion cells, bipolar cells, amacrine cells, Müller cells, and photoreceptor cells express G-CSFR, even in the normal state (Fig. 4) .


Figure 4
View larger version (38K):
[in this window]
[in a new window]

 
FIGURE 4. Double staining confirmed that the G-CSF receptor was expressed on ganglion cells (top left), bipolar cells (middle left), horizontal and amacrine cells (bottom left), Müller cells (top right), and photoreceptor cells (bottom right).

 
We used RT-PCR to further examine the gene expression of G-CSFR in the retina. The expression of G-CSFR was evident and was transiently upregulated by light exposure compared with nontreated retina (1.8-fold upregulation 2 hours after exposure to light, P < 0.001; Fig. 5 ).


Figure 5
View larger version (27K):
[in this window]
[in a new window]

 
FIGURE 5. G-CSFR was expressed in normal retina. (A) The expression level of G-CSFR was transiently increased in light-exposed retina compared with normal control (B).

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The administration of G-CSF alleviated the light-induced damage of retinal photoreceptor cells. This effect was confirmed by histologic and electrophysiologic studies. These results provide the first evidence that G-CSF has a neuroprotective effect in a retinal cell damage model as was shown in the central nervous system damage models. Our findings may be a step toward a novel treatment strategy for retinal diseases caused by photoreceptor cell loss.

The effect of G-CSF seemed to be mediated via G-CSFR on retinal cells, since our result showed that the neuroprotective/antiapoptotic effect was not lost with leukocyte depletion. We confirmed that G-CSFR is expressed in normal adult retina and is upregulated in response to light exposure. Two hours after light exposure, the expression of G-CSFR was transiently increased 1.8-fold. This rapid response to the injury suggests a natural defense mechanism mediated by the G-CSF/G-CSFR pathway. In fact, several neurotrophic factors are upregulated in response to retinal injuries. Prolonged exposure to light increases the levels of basic fibroblast growth factor and ciliary neurotrophic factor in the retina.23 The upregulation of these neurotrophic factors is considered to be a cause of the preconditioning paradigm, which is the resistance to light damage exhibited by animals exposed to bright light for a short time before prolonged exposure.24 Although the intrinsic expression of G-CSF in the retina was not confirmed in the present study, the upregulation of G-CSFR may be another example of the endogenous protective system.

The exact mechanism by which each cell responds to G-CSF/G-CSFR signal has not yet been elucidated. The phosphatidylinositol 3-kinase (PI3K)/Akt pathway,12 25 Janus kinase 2 (JAK2)/ signal transducer and activator of transcription 3 (STAT3) pathway,26 and extracellular signal–regulated kinase (ERK) pathways12 have all been implicated in the inhibition of G-CSF–mediated apoptosis in cerebral models. Future studies are needed to elucidate the molecular and cellular mechanisms underlying the protective effect seen in the present study.

The anti-inflammatory effect of G-CSF could also contribute to the preservation of retinal cells. Park et al.13 showed that G-CSF suppresses inflammation and blood–brain barrier permeability in brain injury. This effect would decrease the secondary cell damage after light exposure. Our data also suggest the putative positive effect of leukocyte depletion: Irradiated mice showed a tendency toward better preservation of retinal cells, although it was not statistically investigated. In addition, G-CSF inhibits iNOS gene expression and decreases iNOS levels,9 27 which should be beneficial in the light-induced damage model.28 29 We speculate that these anti-inflammatory effects could be another explanation for the protection of retinal cells, although this idea remains to be examined by future studies.

Hematopoietic stem cells are another possible factor in the G-CSF–mediated neuroprotective effect. The administration of G-CSF mobilizes hematopoietic stem cells from the bone marrow into peripheral blood.30 We considered it plausible that the stem cells mobilized in response to G-CSF contribute to photoreceptor survival, as was demonstrated for the neuroprotective effect in stroke31 and spinal cord injury models.32 In fact, bone marrow-derived hematopoietic stem cells have been shown to mediate a neuroprotective effect in a retinitis pigmentosa model.19

However, our findings suggest that the effect mediated by the stem cells was minimal in our light-induced damage model. When bone marrow-derived cells were depleted with sublethal irradiation, G-CSF still showed a protective effect. Moreover, the depletion of leukocytes itself seemed to lessen the light-induced damage. This result seems inconsistent with that of the retinitis pigmentosa model.19 We assume that the difference lies in the apoptotic process in different models. In acute injury, such as bright-light–induced damage, the inflammatory harm from the leukocytes would overwhelm the putative protective effect from a small number of stem cells. However, despite this result, the G-CSF strategy may be effective in cases of genetic retinal degeneration.

The results of the present study are applicable to retinal diseases. Although the effect of G-CSF was investigated in a light-induced retinal damage model instead of a retinal degeneration model or a macular degeneration model, the conditions share the main final pathway of photoreceptor apoptosis. In addition, G-CSF seems to mediate a neuroprotective effect on chronic neurodegenerative diseases, as shown in a Parkinson’s disease model,10 as well as in cases of stroke/cerebral ischemia, as shown in an acute damage model. This evidence implies that the neuroprotective effect in the acute retinal damage model can be applied to chronic retinal degenerative diseases, including retinitis pigmentosa.

Investigation of the neuroprotective effect of G-CSF in other ocular diseases such as glaucoma can be rationalized, since G-CSFR is expressed in ganglion cells (Fig. 4) . Glaucoma, which is characterized by ganglion cell death, is a major cause of blindness, and the prevention of disease progression is of great clinical importance.

A combination of other hematopoietic factors would be a rational strategy to increase the effect of G-CSF. The nonhematopoietic roles of hematopoietic factors are currently being examined by many researchers. In addition to G-CSF, erythropoietin is also recognized as a neuroprotectant; in fact, erythropoietin has a neuroprotective effect in light-induced retinal damage,33 34 as well as CNS disease models. Granulocyte–monocyte colony stimulating factor (GM-CSF) has also been shown to have a neuroprotective effect in ischemic cerebral injury.35 Since these cytokines seem to activate different antiapoptotic cascades,5 12 35 36 37 the combination of these cytokines may have an additive effect. Further studies are needed to examine the safety and additive effect of combination therapy.

Finally, we showed the beneficial effect of G-CSF on light-induced retinal damage. G-CSF has already been proven safe for clinical use and has been extensively used for more than 10 years. Systemic administration of G-CSF is expected to sufficiently activate this neuroprotective pathway since G-CSF passes across the intact blood–brain barrier.12 38 Further in vivo studies are needed to confirm the efficacy of the therapy in isolation or in combination with other hematopoietic cytokines.


    Footnotes
 
Presented at the annual meeting of the Association for Research in Vision and Ophthalmology, Fort Lauderdale, Florida, May 2008.

Supported by Grant 17689045 from the Ministry of Education, Science, and Culture of Japan.

Submitted for publication January 9, 2008; revised May 9, June 26, and July 21, 2008; accepted October 3, 2008.

Disclosure: A. Oishi, None; A. Otani, None; M. Sasahara, None; H. Kojima, None; H. Nakamura, None; Y. Yodoi, None; N. Yoshimura, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Atsushi Otani, Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, Shougoin Kawaharacho 54, Sakyouku, Kyoto 606-8507, Japan; otan{at}kuhp.kyoto-u.ac.jp.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hafezi F, Steinbach JP, Marti A, et al. The absence of c-fos prevents light-induced apoptotic cell death of photoreceptors in retinal degeneration in vivo. Nat Med. 1997;3:346–349.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  2. Wenzel A, Grimm C, Samardzija M, Reme CE. Molecular mechanisms of light-induced photoreceptor apoptosis and neuroprotection for retinal degeneration. Prog Retin Eye Res. 2005;24:275–306.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  3. Begley CG, Lopez AF, Nicola NA, et al. Purified colony-stimulating factors enhance the survival of human neutrophils and eosinophils in vitro: a rapid and sensitive microassay for colony-stimulating factors. Blood. 1986;68:162–166.[Abstract/Free Full Text]
  4. Hu B, Yasui K. Effects of colony-stimulating factors (CSFs) on neutrophil apoptosis: possible roles at inflammation site. Int J Hematol. 1997;66:179–188.[CrossRef][Medline][Order article via Infotrieve]
  5. Schabitz WR, Kollmar R, Schwaninger M, et al. Neuroprotective effect of granulocyte colony-stimulating factor after focal cerebral ischemia. Stroke. 2003;34:745–751.[Abstract/Free Full Text]
  6. Six I, Gasan G, Mura E, Bordet R. Beneficial effect of pharmacological mobilization of bone marrow in experimental cerebral ischemia. Eur J Pharmacol. 2003;458:327–328.[CrossRef][Medline][Order article via Infotrieve]
  7. Gibson CL, Bath PM, Murphy SP. G-CSF reduces infarct volume and improves functional outcome after transient focal cerebral ischemia in mice. J Cereb Blood Flow Metab. 2005;25:431–439.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  8. Gibson CL, Jones NC, Prior MJ, Bath PM, Murphy SP. G-CSF suppresses edema formation and reduces interleukin-1beta expression after cerebral ischemia in mice. J Neuropathol Exp Neurol. 2005;64:763–769.[Medline][Order article via Infotrieve]
  9. Komine-Kobayashi M, Zhang N, Liu M, et al. Neuroprotective effect of recombinant human granulocyte colony-stimulating factor in transient focal ischemia of mice. J Cereb Blood Flow Metab. 2006;26:402–413.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  10. Meuer K, Pitzer C, Teismann P, et al. Granulocyte-colony stimulating factor is neuroprotective in a model of Parkinson’s disease. J Neurochem. 2006;97:675–686.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  11. Shyu WC, Lin SZ, Lee CC, Liu DD, Li H. Granulocyte colony-stimulating factor for acute ischemic stroke: a randomized controlled trial. CMAJ. 2006;174:927–933.[Abstract/Free Full Text]
  12. Schneider A, Kruger C, Steigleder T, et al. The hematopoietic factor G-CSF is a neuronal ligand that counteracts programmed cell death and drives neurogenesis. J Clin Invest. 2005;115:2083–2098.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  13. Park HK, Chu K, Lee ST, et al. Granulocyte colony-stimulating factor induces sensorimotor recovery in intracerebral hemorrhage. Brain Res. 2005;1041:125–131.[CrossRef][Medline][Order article via Infotrieve]
  14. Lee ST, Chu K, Jung KH, et al. Granulocyte colony-stimulating factor enhances angiogenesis after focal cerebral ischemia. Brain Res. 2005;1058:120–128.
  15. Zavala F, Abad S, Ezine S, Taupin V, Masson A, Bach JF. G-CSF therapy of ongoing experimental allergic encephalomyelitis via chemokine- and cytokine-based immune deviation. J Immunol. 2002;168:2011–2019.[Abstract/Free Full Text]
  16. Solaroglu I, Cahill J, Jadhav V, Zhang JH. A novel neuroprotectant granulocyte-colony stimulating factor. Stroke. 2006;37:1123–1128.[Abstract/Free Full Text]
  17. Grigg AP, Roberts AW, Raunow H, et al. Optimizing dose and scheduling of filgrastim (granulocyte colony-stimulating factor) for mobilization and collection of peripheral blood progenitor cells in normal volunteers. Blood. 1995;86:4437–4445.[Abstract/Free Full Text]
  18. Friedlander M, Dorrell MI, Ritter MR, et al. Progenitor cells and retinal angiogenesis. Angiogenesis. 2007;10:89–101.[Medline][Order article via Infotrieve]
  19. Otani A, Dorrell MI, Kinder K, et al. Rescue of retinal degeneration by intravitreally injected adult bone marrow-derived lineage-negative hematopoietic stem cells. J Clin Invest. 2004;114:765–774.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  20. Bonilla S, Silva A, Valdes L, Geijo E, Garcia-Verdugo JM, Martinez S. Functional neural stem cells derived from adult bone marrow. Neuroscience. 2005;133:85–95.[CrossRef][Medline][Order article via Infotrieve]
  21. Chan-Ling T, Baxter L, Afzal A, et al. Hematopoietic stem cells provide repair functions after laser-induced Bruch’s membrane rupture model of choroidal neovascularization. Am J Pathol. 2006;168:1031–1044.[Abstract/Free Full Text]
  22. Li Y, Reca RG, Atmaca-Sonmez P, et al. Retinal pigment epithelium damage enhances expression of chemoattractants and migration of bone marrow-derived stem cells. Invest Ophthalmol Vis Sci. 2006;47:1646–1652.[Abstract/Free Full Text]
  23. Wen R, Cheng T, Song Y, et al. Continuous exposure to bright light upregulates bFGF and CNTF expression in the rat retina. Curr Eye Res. 1998;17:494–500.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  24. Liu C, Peng M, Laties AM, Wen R. Preconditioning with bright light evokes a protective response against light damage in the rat retina. J Neurosci. 1998;18:1337–1344.[Abstract/Free Full Text]
  25. Dong F, Larner AC. Activation of Akt kinase by granulocyte colony-stimulating factor (G-CSF): evidence for the role of a tyrosine kinase activity distinct from the Janus kinases. Blood. 2000;95:1656–1662.[Abstract/Free Full Text]
  26. Shimozaki K, Nakajima K, Hirano T, Nagata S. Involvement of STAT3 in the granulocyte colony-stimulating factor-induced differentiation of myeloid cells. J Biol Chem. 1997;272:25184–25189.[Abstract/Free Full Text]
  27. Deetjen C, Frede S, Smolny M, Seibel M, Schobersberger W, Hoffmann G. Inhibition of inducible nitric oxide synthase gene expression and nitric oxide synthesis in vascular smooth muscle cells by granulocyte-colony stimulating factor in vitro. Immunopharmacology. 1999;43:23–30.[Medline][Order article via Infotrieve]
  28. Donovan M, Carmody RJ, Cotter TG. Light-induced photoreceptor apoptosis in vivo requires neuronal nitric-oxide synthase and guanylate cyclase activity and is caspase-3-independent. J Biol Chem. 2001;276:23000–23008.[Abstract/Free Full Text]
  29. Piehl L, Capani F, Facorro G, et al. Nitric oxide increases in the rat retina after continuous illumination. Brain Res. 2007;1156:112–119.[Medline][Order article via Infotrieve]
  30. Demetri GD, Griffin JD. Granulocyte colony-stimulating factor and its receptor. Blood. 1991;78:2791–2808.[Free Full Text]
  31. Shyu WC, Lin SZ, Yang HI, et al. Functional recovery of stroke rats induced by granulocyte colony-stimulating factor-stimulated stem cells. Circulation. 2004;110:1847–1854.[Abstract/Free Full Text]
  32. Koda M, Nishio Y, Kamada T, et al. Granulocyte colony-stimulating factor (G-CSF) mobilizes bone marrow-derived cells into injured spinal cord and promotes functional recovery after compression-induced spinal cord injury in mice. Brain Res. 2007;1149:223–231.[Medline][Order article via Infotrieve]
  33. Grimm C, Wenzel A, Groszer M, et al. HIF-1-induced erythropoietin in the hypoxic retina protects against light-induced retinal degeneration. Nat Med. 2002;8:718–724.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  34. Grimm C, Wenzel A, Stanescu D, et al. Constitutive overexpression of human erythropoietin protects the mouse retina against induced but not inherited retinal degeneration. J Neurosci. 2004;24:5651–5658.[Abstract/Free Full Text]
  35. Schabitz WR, Kruger C, Pitzer C, et al. A neuroprotective function for the hematopoietic protein granulocyte-macrophage colony stimulating factor (GM-CSF). J Cereb Blood Flow Metab. 2008;28:29–43.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  36. Digicaylioglu M, Lipton SA. Erythropoietin-mediated neuroprotection involves cross-talk between Jak2 and NF-kappaB signalling cascades. Nature. 2001;412:641–647.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  37. Celik M, Gokmen N, Erbayraktar S, et al. Erythropoietin prevents motor neuron apoptosis and neurologic disability in experimental spinal cord ischemic injury. Proc Natl Acad Sci U S A. 2002;99:2258–2263.[Abstract/Free Full Text]
  38. Zhao LR, Navalitloha Y, Singhal S, et al. Hematopoietic growth factors pass through the blood-brain barrier in intact rats. Exp Neurol. 2007;204:569–573.[CrossRef][Web of Science][Medline][Order article via Infotrieve]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
iovs.08-1711v1
49/12/5629    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oishi, A.
Right arrow Articles by Yoshimura, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oishi, A.
Right arrow Articles by Yoshimura, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS