IOVS Learning & Memory
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2008;49:1696-1704.)
© 2008 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.07-1272

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Siffroi-Fernandez, S.
Right arrow Articles by Hicks, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Siffroi-Fernandez, S.
Right arrow Articles by Hicks, D.

FGF19 Exhibits Neuroprotective Effects on Adult Mammalian Photoreceptors In Vitro

Sandrine Siffroi-Fernandez,1 Marie-Paule Felder-Schmittbuhl,1 Hemant Khanna,2 Anand Swaroop,2,3 and David Hicks1

1From the Laboratoire de Neurobiologie des Rythmes, Institut des Neurosciences Cellulaires et Intégratives, Strasbourg, France; and the 2Departments of Ophthalmology and Visual Sciences and 3Human Genetics, University of Michigan, Ann Arbor, Michigan.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. Several fibroblast growth factors (FGFs) exhibit neuroprotective influences against retinal photoreceptor degeneration. The expression of FGF receptor (FGFR) 4 on photoreceptors suggests a specific ligand, FGF-19, might also be beneficial. The authors hence examined the potential role of FGF-19 in this regard.

METHODS. Adult human retinal sections were processed for anti-FGFR-4 immunohistochemistry. Total RNA and proteins were extracted from parallel cultures of human Y79 retinoblastoma and primary adult pig photoreceptors; RNA samples were used for RT-PCR analysis of FGF-19, and proteins were subjected to immunoprecipitation for FGFR-1 and FGFR-4 or to Western blotting of FGF-19. Cultures were incubated with increasing concentrations of FGF-19 before extraction and Western blotting for phosphotyrosine. Photoreceptor cultures were screened for cell survival and processed for immunocytochemistry using anti-neural retina leucine zipper (Nrl) antibody.

RESULTS. FGF-19 mRNA was detected in adult pig retinal pigment epithelial cells, and FGF-19 protein was found in cell extracts and conditioned medium prepared from retinal pigment epithelium. The addition of FGF-19 to Y79 retinoblastoma or primary adult pig photoreceptor cultures led to time- and dose-dependent changes in proliferation (for Y79) or survival (for primary photoreceptors). FGF-19 induced the phosphorylation of an FGFR-4-immunoreactive band of approximately 80 kDa and led to the heterodimerization of FGFR-1 and FGFR-4. Y79 and primary photoreceptor cells maintained in serum-supplemented media exhibited Nrl immunoreactivity by Western blotting, which decreased after serum deprivation. The addition of FGF-19 led to the reexpression of Nrl immunoreactivity in both culture models.

CONCLUSIONS. These data indicate a physiological role for FGF-19 in adult photoreceptor phenotypic maintenance and survival and argue in favor of its use as a neuroprotectant.


Photoreceptor degeneration occurs as a pathologic response to numerous environmental and genetic disorders, leading to progressive vision loss and blindness. The different types of blinding conditions—among which are inherited retinal degenerations such as retinitis pigmentosa (typified by loss of peripheral vision) and age-related macular degeneration (in which central vision is compromised)—result in enormous suffering for the affected persons and huge socioeconomic burdens on society.1 2 3 4 Despite tremendous progress in identifying disease mechanisms, few therapeutic approaches are available to limit cell demise. One general area that has received much attention is neuroprotection, by which the administration of a pharmacologic reagent can slow down cell loss without addressing directly the genetic cause.5 Among the multiple potential approaches, neurotrophic factors represent an important subclass.6 Several different neurotrophic factors have shown beneficial effects on photoreceptor loss in experimental animal models; these include ciliary neurotrophic factor (CNTF),7 8 glial cell line-derived neurotrophic factor (GDNF),9 10 and several members of the fibroblast growth factor (FGF) family.11 12 13 14 With respect to the latter, intraocular injections of either acidic or basic FGF (FGF-1 and FGF-2 using current nomenclature) reduced the rate of photoreceptor death in a rat model of inherited retinal degeneration.11 The same laboratory and others examined the efficacy of FGF-2 in a range of genetic and induced degenerations, including light damage, mechanical damage, naturally occurring hereditary degeneration, and transgenic animals in vivo.12 13 14 Our own laboratory has used in vitro retinal models to examine the role of FGF-2 in photoreceptor differentiation15 and survival16 17 and to examine the intracellular signaling pathway recruited by FGF-2 treatment.18 Although most of these studies have been performed using FGF-2, use of other family members as neuroprotectants has also been addressed.19

We hypothesize that rational design of neurotrophic factor-based therapy should be based on receptor expression profiles. We demonstrated that high-affinity FGF receptors (FGFRs) are widespread throughout the retina but exhibit distinctly different distributions, depending on the type.20 21 FGFR-1 and FGFR-2 are expressed at high levels throughout the retina, FGFR-3 is concentrated within the inner retina, especially within the retinal ganglion cells (RGCs),21 and FGFR-4 is abundantly expressed by photoreceptors and photoreceptor-derived retinoblastoma.22 23 These receptor profiles can be used as a guide to select candidate FGF family members. The preferred ligand for FGFR-3 is FGF-9,24 and we showed this molecule exerts dose-dependent neurotrophic effects on RGCs in vitro.21 FGF-19 (FGF-15 in the mouse25 ) is a distant member of the FGF family and exhibits unique binding to FGFR-4.26 Although FGF-19 was shown to be involved in the development of ocular tissue27 28 29 and to be expressed by the embryonic retina,26 nothing is known of its expression or biological effects in adult tissue. We show here that FGF-19 is expressed by cells adjacent to the photoreceptor layer and that in purified adult photoreceptor cultures, FGF-19 induces dose- and time-dependent phosphorylation of FGFR-4, up-regulates the expression of specific transcription factors, improves survival, and may, hence, represent a useful therapeutic approach to treating retinal degeneration.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Antibodies, Growth Factors, and Tissue Culture Supplies
FGF-1, FGF-2, FGF-4, and FGF-19 were purchased from R&D Systems Ltd (Abingdon, UK). Anti-rhodopsin monoclonal antibody rho-4D2 has been characterized extensively.30 Anti-neural retina leucine (Nrl) antibodies were prepared as described previously.31 Anti-FGF-19 antibody was from R&D Systems; anti-FGFR-1 and FGFR-4 antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). Tissue culture media and fetal calf serum (FCS) were purchased from Invitrogen (Carlsbad, CA); other tissue culture reagents (laminin, poly-lysine, trypsin) were tissue culture grade from Sigma (St. Louis, MO). The SUM breast cancer cell line, overexpressing all FGFR isoforms, was used as a positive control in Western blotting studies.32 The cell line was a generous gift of Steven Ethier (University of Michigan, Ann Arbor, MI)

Retinal Immunohistochemistry
Retinal immunohistochemistry was performed as described previously.20 Human donor eyes were acquired from the University of Iowa Center for Macular Degeneration (generous gift of Gregory Hageman, University of Iowa, Iowa City, IA) and were processed within 12 hours of death. Institutional review board committee approval for the use of human donor tissues was obtained from the Human Subjects Committee of the University of Iowa. Retinas were dissected free from the posterior eyecup and fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 2 hours, cut into 1-cm2 fragments, and passaged through PBS containing 10%, 15%, and 20% sucrose, respectively, each for 1 hour. Retinal specimens were frozen in OCT and sectioned at 10 µm by cryostat. Sections were permeabilized in 0.1% Triton X-100 for 5 minutes, then preincubated in PBS containing 0.1% bovine serum albumin, 0.1% Tween 20, 5% normal goat serum, and 0.1% sodium azide (Buffer A) for 30 minutes. Sections were incubated in rabbit polyclonal anti-FGFR-4 IgG (sc-124, carboxyl terminal human FGFR-4; Santa Cruz Biotechnology) diluted 1:200 in buffer A overnight at 4°C. After extensive washing, slides were incubated in goat anti-rabbit IgG coupled to fluorescent dye (Alexa 488; Molecular Probes, Eugene, OR) 1 µg/mL for 2 hours. The antibody solution also contained 1 µg/mL 4,6-diaminodiphenyl-2-phenylindole (DAPI; Sigma-Aldrich, Poncy-Cergoise, France). Controls were performed by preincubating a fivefold excess of the immunizing peptide together with the primary antibody solution for 2 hours before addition to sections. Slides were rinsed thoroughly, coverslipped in PBS/glycerol 1:1, and examined under a fluorescence microscope (Optiphot 2; Nikon, Tokyo, Japan) equipped with the digital image analysis system (Visiolab; Biocom, Lyon, France). Images were prepared using imaging software (Photoshop CS 8.0; Adobe, Mountain View, CA).

Cell Culture and Growth Factor Treatments
Y79 retinoblastoma (initial seeding density, 105 cells/mL) was grown in 6 x 35-mm culture well plates in RPMI 1640 medium containing 15% FCS for 3 days, and serum deprived for 24 to 72 hours. They were then treated with different FGFs for 24 hours—FGF-1 (50 ng/mL), FGF-2 (10 ng/mL), FGF-4 (10 ng/mL), and FGF-19 (5–100 ng/mL)—and analyzed.

Primary cultures of enriched adult pig photoreceptors were prepared as described previously.17 33 Retinas were dissected from adult pig eyes into fresh cold CO2-independent Dulbecco modified Eagle medium (DMEM), chopped into small fragments, washed twice in Ringer solution (Ca2+ and Mg2+ free), and incubated in 0.5 mL 0.2% activated papain (Worthington Biochemical Corp., Freehold, NJ) in the same buffer for 20 minutes at 37°C. The tissue was gently dissociated, and the pooled supernatants containing photoreceptors were centrifuged and resuspended in medium (Neurobasal A [Nb-A]; Invitrogen)/2%FCS and antibiotics (10 U/mL penicillin and 10 µg/mL streptomycin). Viable cell numbers were estimated after trypan blue vital dye exclusion, and cells were seeded into 6 x 35-mm tissue culture plates at an initial density of 5 x 105 cells/cm2. Serum-supplemented medium was changed 48 hours after seeding with Nb-A-containing B-27 supplement.17 Cultures were left 24 hours in chemically defined medium, then incubated with recombinant FGF-19 (0–100 ng/mL) (R&D Systems) for 5 minutes to 24 hours, according to the particular experiment.

Primary cultures of retinal pigment epithelium (RPE) were prepared from adult pig eyes as described previously for bovine RPE.34 Cells were maintained in RPMI/10% FCS. After they reached confluence, they were rinsed twice with serum-free medium, then incubated for 24 hours in chemically defined medium (RPMI alone). This medium was collected and concentrated 10x to 20x by solute filtration and stored at –20°C.

Protein Extraction and Western Blot Analysis after FGF-19 Stimulation
Analyses were performed largely according to previously published methods.23 After the different incubations, cells were immediately frozen in liquid nitrogen, thawed on ice, and centrifuged (900g) for 5 minutes. Pellets were resuspended in cold lysis buffer (100 mM Tris [pH 7.4], 150 mM sodium fluoride, 1 mM EDTA, 1% Nonidet P40, protease inhibitor cocktail and phosphatase inhibitor, 1 mM NaVO4) and stored on crushed ice. Antibody-tagged beads were prepared by incubating anti-FGFR-1 or anti-FGFR-4 20 µg in 100 µL lysis buffer with protein A-agarose beads for 2 hours at room temperature, prerinsed twice in PBS. Antibody-coated beads were incubated with photoreceptor extract overnight with gentle agitation at 4°C. Beads were washed in excess lysis buffer, sedimented, and resuspended in 10 µL lysis buffer, to which was added an equal volume of Laemmli buffer. Protein concentration was determined using Bio-Rad (Hercules, CA) protein assay reagent. Equal amounts of protein were analyzed by SDS-PAGE, followed by immunoblotting. Solubilized proteins were separated by 7.5% SDS-PAGE and transferred to nitrocellulose membranes using a semidry transfer system (Bio-Rad). Membranes were blocked with TBS, 3% dry milk, and 0.1% Tween 20 for 1 hour at room temperature, then incubated with mouse monoclonal anti-phosphotyrosine (Upstate Biotechnology, Lake Placid, NY), rabbit polyclonal FGFR-4, or FGFR-1 (Santa Cruz Biotechnology) antibodies in TBS, 0.3% dry milk, and 0.1% Tween 20 overnight at 4°C. Bound primary antibody was detected by means of horseradish peroxidase-conjugated goat anti-mouse or goat anti-rabbit secondary antibodies diluted 1:10,000 in TBS, 0.3% dry milk, and 0.1% Tween 20 for 2 hours at room temperature. Immunoreactive bands were visualized using an enhanced chemiluminescence kit according to the manufacturer’s instructions (SuperSignal ECL+; Pierce Biotechnology, Brebières, France).

Messenger RNA Extraction from Retina and RPE
Total RNA was extracted from freshly isolated adult pig RPE and retina using the (RNAble; Eurobio Laboratoires, Courtaboeuf, France) kit according to the manufacturer’s instructions. Neural retinas were removed from posterior eyecups, and RPE was harvested by trypsin digestion followed by gentle aspiration.34 Fragments of DNA of FGF-19, β-actin, and RPE65 were amplified from total RNA by reverse transcriptase-polymerase chain reaction (RT-PCR) with the use of specific primers chosen from a BLAST search of highly conserved sequences within the databank or from published sequence data35 : FGF-19 forward, 5' CTCTMCAGCTGCTTYCTGCGCATC; FGF-19 reverse, 5' TTGTAGCCRTCDGGRCGGATCTCC (expected product size, 232 bp); RPE-65, forward, 5' AATGGATTTCTGATTGTGGA; RPE-65 reverse, 5' TCAGGATCTTTTGAACAGTC (expected product size, 642 bp); β-actin forward, 5' ATCCACGAAACTACCTTCAACTC; β-actin reverse, 5' GAGGAGCAATGATCTTGATCTTC (expected product size, 177 bp).

After 30 cycles of amplification, PCR products were separated by electrophoresis in 2% agarose gels and visualized by ethidium bromide staining.

NRL Immunochemistry
For immunocytochemical studies, medium was removed 24 hours after FGF-19 treatment, and cells were fixed in 4% paraformaldehyde in PBS for 15 minutes. Cells were permeabilized for 5 minutes using 0.1% Triton X-100, then preincubated in blocking buffer (PBS containing 0.1% bovine serum albumin, 0.1% Tween 20, and 0.1% sodium azide) for 30 minutes. Cells were incubated overnight in affinity-purified anti-NRL antiserum (1:1000 dilution) and monoclonal anti-rhodopsin antibody rho-4D2, rinsed thoroughly, and incubated with secondary antibodies (anti-rabbit IgG-Alexa 594 and anti-mouse IgG-Alexa 488) combined with 4,6-di-amino-phenyl-indolamine (DAPI) (all from Molecular Probes) for 2 hours. Cells were washed, mounted in PBS/glycerol, and examined under a fluorescence microscope (Optiphot 2; Nikon). All images were captured using a charge-coupled device camera and transferred to a dedicated personal computer. The same capture parameters were used for each stain, and final panels were made using untreated images for direct comparison of staining intensities.36

For immunoblotting studies, cells were sonicated in PBS, and clarified supernatant was used for further analysis. Protein concentration was determined using Bio-Rad protein assay reagent. Equal amounts of proteins were analyzed by SDS-PAGE, followed by immunoblotting. Proteins were detected using anti-NRL polyclonal antibody as described.31 36 Immunoblots from three independent experiments were analyzed.

Cell Proliferation and Survival Assays
Y-79 cells were grown in 6 x 35-mm tissue culture plates as described, then serum-deprived by maintenance in RPMI medium alone for 72 hours. Recombinant human FGF-19 (10–100 ng/mL) was then added to each well, with negative controls receiving the same volume of medium alone and positive controls receiving RPMI/15% FCS. Cultures were left for 24 hours, and the cells were collected and sedimented at 1000g for 10 minutes. Viable cell numbers were determined by counting on a hemocytometer (under conditions of trypan blue exclusion to exclude dead cells), with triplicate wells for each concentration.

Adult pig photoreceptor cultures were prepared as described and transferred to Nb-A alone for 24 hours, and test wells were supplemented with increasing concentrations of FGF-19 (10–100 ng/mL) for 24 hours at 37°C. Cell viability was assayed using the validated neutral red vital dye uptake assay37 (Sigma-Aldrich Sarl, Saint Quentin Fallavier, France). The medium was discarded, and the cultures were washed with PBS. Cells were incubated in assay solution (0.033% neutral red in HEPES buffer, pH 7.4) and incubated for 2 hours at 37°C. Thereafter, cells were washed twice with the same buffer and dried at room temperature, and the neutral red dye was extracted in solubilization buffer (1% acetic acid, 50% ethyl alcohol). Optical density was measured at 570 nm, and data were expressed as arbitrary units.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
We examined the presence of FGFR-4-like immunoreactivity within the adult postmortem human retina; although antibody binding was visible throughout the retina, especially heavy immunolabel was present at the surfaces of the photoreceptor inner segments (Fig. 1) . This location suggested that such receptors might be activated by ligands within the subretinal space, and we then searched for the presence of FGF-19 within one of the principal cell types—the RPE—bordering this space. FGF-19 mRNA was clearly detected in extracts prepared from adult pig RPE primary cultures and in extracts of neural retina (Fig. 2A) . When amplified PCR products were normalized to β-actin obtained from the same samples (Fig. 2B) , FGF-19 expression was higher in RPE than in retina. Coamplification of mRNA of the RPE-specific marker RPE65 showed strong label in the RPE, as expected, and the presence of a faint band in neural retina preparations (Fig. 2C) .


Figure 1
View larger version (114K):
[in this window]
[in a new window]

 
FIGURE 1. FGFR-4 is expressed by photoreceptors. Immunohistochemical staining of postmortem adult human retinal sections (A) reveals prominent FGFR-4 antibody binding to photoreceptor inner segments (IS) and cell bodies (CB) (B). The outer segments (OS) are only faintly labeled. Scale bar, 20 µm.

 

Figure 2
View larger version (43K):
[in this window]
[in a new window]

 
FIGURE 2. FGFR-4 mRNA is present in adult retina and RPE. (A) Expression levels of FGF-19 were detected by RT-PCR in extracts of primary cultures of porcine RPE (RP) and whole retina (Ret). Distilled water (W) was used as negative control. Amplification product of the expected size (bp) was present in both samples. (B) Amplification of β-actin from the same samples demonstrated that FGF-19 levels were higher in RPE than in retina. (C) Amplification of RPE-65, an RPE-specific marker, demonstrated strong signal in RPE, as expected, and weak signal in the retina, indicating some contamination of the latter.

 
Immunoblotting for the presence of FGF-19 protein was performed on a number of cell preparations. SUM and Y-79 retinoblastoma exhibited a major immunoreactive band of approximately 34 kDa, within both cellular and extracellular (conditioned medium) compartments (Fig. 3) . Retina, on the other hand, showed relatively low levels of this immunoreactive band, particularly in the conditioned medium fraction; RPE had intermediate levels, both in cell cytoplasm and medium fractions (Fig. 3) . Y-79, retina, and RPE cellular fractions also displayed a weaker band at approximately 37 kDa.


Figure 3
View larger version (31K):
[in this window]
[in a new window]

 
FIGURE 3. FGFR-4 protein is present in RPE. Total protein extracts were prepared from cellular (C) and medium (soluble [S]) fractions of different tissues. SUM breast cancer line overexpresses many FGFRs32 and was used as a positive control. All samples displayed immunoreactivity of a band of approximately 34 kDa, and all cellular fractions also showed staining at approximately 37 kDa. Intensity of immunostaining varied between samples (in descending order, SUM>Y-79>RPE>retina).

 
Addition of recombinant human FGF-19 to serum-deprived Y-79 cells led to dose-dependent increases in proliferation (Fig. 4A) . Importantly, the addition of recombinant human FGF-19 to purified adult porcine photoreceptors maintained in chemically defined medium led to a dose-dependent increase in cell survival. The addition of 10 ng/mL increased survival by 48%, to the same extent as the readdition of 2% FCS. The addition of 20 and 40 ng/mL increased survival by approximately 100% in both cases (Fig. 4B) .


Figure 4
View larger version (11K):
[in this window]
[in a new window]

 
FIGURE 4. FGF-19 stimulates the proliferation of retinoblastoma and the survival of primary photoreceptors in vitro. Serum-deprived Y-79 displayed dose-dependent increases in cell number, with maximal stimulation approximately 20 ng/mL and ED50 of approximately 15 ng/mL. Higher concentrations of FGF-19 (100 ng/mL) induced less strong proliferation, possibly because of receptor internalization. *P < 0.05; **P < 0.01; ***P < 0.001. Cell survival in cultured adult photoreceptors was assayed by neutral red vital dye. Readdition of 2% FCS and FGF-19 (5 ng/mL) both induced approximately 50% increases in values, whereas 20 ng/mL and 40 ng/mL FGF-19 led to roughly double the number of surviving cells. *P < 0.5; **P < 0.1.

 
Analysis of FGF-19 phosphorylation of FGFR-4 was performed using Y-79 cells and cultured photoreceptors. Both cell types gave similar profiles by antiphosphotyrosine immunoblotting of protein immunoprecipitated using anti-FGFR-4 antibody. A single band of approximately 80 kDa was detectable, showing faint labeling in unstimulated, and after 5 and 10 minutes of FGF-19 treatment, then becoming progressively stronger by 20 and 30 minutes. The 80 kDa band was still activated after 45 minutes (Fig. 5) . In parallel experiments, we immunoprecipitated FGF-19-treated cultures with anti-FGFR-4 antibody and then immunoblotted the membranes with anti-FGFR-1. FGFR-1 immunoblotting of proteins pulled down by anti-FGFR-4 showed a single band of approximately 110 kDa, present at all time points examined, but with increasing intensity after FGF-19 addition at 5 minutes and maximal at 15 minutes; thereafter, the intensity of the band decreased but was still not at baseline levels by 45 minutes (Fig. 5C) .


Figure 5
View larger version (56K):
[in this window]
[in a new window]

 
FIGURE 5. FGF-19 stimulates tyrosine phosphorylation of photoreceptor proteins. (A) FGF-19 (50 ng/mL) addition to Y-79 cells followed by anti-FGFR-4 immunoprecipitation showed increased phosphotyrosine immunoreactivity at approximately 80 kDa. This immunoreactivity appeared relatively slowly, was still equal to baseline levels after 5 minutes of FGF-19 addition, increased after 15 minutes to reach maximal levels at 30 minutes, and was still high after 45 minutes. (B) Similar analyses using cultured adult photoreceptors showed largely similar results, with relatively slow onset of phosphotyrosine immunoreactivity, in this case reaching maximal levels after 45 minutes. Later time points were not examined. (C) Immunoprecipitation of FGF-19-stimulated photoreceptors with anti-FGFR-4 antisera followed by immunoblotting with anti-FGFR-1 antibody showed the presence of a single band of approximately 110 kDa. Intensity of the band increased with increasing time of exposure, reaching a maximum after 15 minutes, and then slowly decreased to near-baseline levels by 45 minutes. Immunoblots are representative of three independent experiments. IB, immunoblot; IP, immunoprecipitation; PR, photoreceptor cultures; PT, anti-phosphotyrosine antibody.

 
We also examined the effects of the addition of FGF-19 on steady state expression levels of Nrl, a key rod-specific transcription factor involved in photoreceptor differentiation and survival. In Y-79 retinoblastoma, serum starvation led to almost complete disappearance of Nrl expression; the addition of FGF-19 led to a dose-dependent reappearance of this factor, with increased expression at 10 ng/mL and strong reexpression with 100 ng/mL (Fig. 6A) . Other FGFs with published affinity for FGFR-4 were also tested for their capacity to stimulate Nrl levels. FGF-1, FGF-2, and FGF-4 were all tested in this assay and found to enhance Nrl expression (Fig. 6B) . Immunocytochemical staining of purified adult photoreceptor cultures for rod opsin and Nrl supported these data. Depletion of serum led to weak staining of Nrl within rod nuclei, whereas supplementation with FGF-19 led to increased nuclear levels (Fig. 6C) .


Figure 6
View larger version (17K):
[in this window]
[in a new window]

 
FIGURE 6. FGFs stimulate the expression of a rod-specific transcription factor in retinoblastoma and primary photoreceptors in vitro. (A) Nrl zipper is constitutively expressed by serum-supplemented Y-79 and primary photoreceptors.36 Serum deprivation leads to greatly diminished expression of the approximately 30-kDa isoform, which can be partly restored by the addition of FGF-19 for 24 hours (arrow). The Nrl antibody cross-reacts with a 45-kDa protein unrelated to Nrl that shows no variation between treatments (asterisk). (B) Similar analyses with additional FGFs showed increased expression of the same band after 24 hours: FGF-1, 100 ng/mL (F1); FGF-2, 20 ng/mL (F2); FGF-4, 20 ng/mL (F4). (C) Strong nuclear Nrl immunoreactivity was seen in FCS-supplemented adult photoreceptor cultures, colocalizing with DAPI staining and rod opsin antibody binding (AC). Serum deprivation of cultures led to reduced Nrl expression (DF). Addition of FGF-19 (50 ng/mL) for 24 hours restored Nrl expression levels (GI). All images were exposed using the same conditions. Scale bar, (I) 12 µm. In all cases, the readdition of FCS served as positive control.

 
Finally, because we detected FGF-19 in conditioned medium prepared from RPE monolayers, we also examined the effects of this conditioned medium on some of the parameters investigated for FGF-19. Notably, the incubation of adult photoreceptor cells with RPE medium led to weak tyrosine phosphorylation of a band of approximately 80 kDa (Fig. 7A) . Such treatment also led to increased levels of at least one Nrl isoform (approximately 35 kDa), as seen in Western blots (Fig. 7B) .


Figure 7
View larger version (37K):
[in this window]
[in a new window]

 
FIGURE 7. RPE-conditioned medium replicates some of the effects seen with FGF-19. (A) Incubation of cultured photoreceptors with RPE-conditioned medium followed by protein extraction and phosphotyrosine blotting show a weak band of approximately 80 kDa (arrow) and some faint lower bands of approximately 64 and 50 kDa. (B) Nrl immunoreactivity in Western blots shows multiple bands, representing different phosphorylated isoforms. Compared with whole retina (Ret), cultured purified adult photoreceptors (PR) show reduced immunoreactivity of bands at approximately 32 and 35 kDa. The addition of RPE-conditioned medium (PR-CM) led to increased expression of the 35-kDa band (arrow).

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
These data suggest strongly that FGF-19, acting through FGFR-4 localized within photoreceptors, exerts beneficial effects on photoreceptor survival and phenotypic expression. Furthermore, the detection of endogenous FGF-19 within and secreted by the adjacent RPE suggests that FGF-19 may play a role in mature photoreceptor physiology in vivo. We detected FGF-19 mRNA and protein within the different cell types tested, with some variation, depending on the cell type and compartment. By our immunoblotting experiments, native FGF-19 had an apparent molecular mass (approximately 34 kDa) superior to the calculated weight (21 kDa) and hence did not migrate as expected. We were unable to find other published data on native FGF-19, but such behavior may be related to the unusual protein structure.38 In addition, a second, fainter, immunoreactive band was seen at approximately 37 kDa, present in all the cellular fractions but absent from media (except for Y-79 cells; Fig. 3 ). FGF-19 is unusual for an FGF family member in that it has a 22-amino acid signal sequence.39 Hence, the longer immunoreactive form present in cell extracts may represent this precursor. Possibly the Y-79 medium preparation was contaminated with lysed cellular material; indeed, this preparation also contained an approximately 32-kDa immunoreactive band, which may represent a partially proteolyzed form. Among the different tissue samples, retina contained the least FGF-19. This is consistent with published reports showing that it is strongly expressed in developing retina but that it downregulates shortly after birth to become restricted to some inner retinal cells.28

Of the five known high-affinity FGFRs, FGFR-4 is relatively little studied, especially within the central nervous system. In the mature brain, it is reported to be expressed principally within the median habenular nucleus,40 whereas we have shown previously that it is expressed by adult retina,20 22 predominantly within photoreceptors. It is more widely expressed during the development of the central nervous system39 and has been reported to be a precocious marker of human macula, where it may play a role in cone differentiation.41 42 Transgenic Xenopus, carrying a dominant-negative FGFR-4 construct targeted to the retina, displays profound defects in retinal formation,43 underscoring the importance of this receptor in retinal development. Although the activation and intracellular signaling of FGFR-4 are only poorly known, data indicate several notable differences with respect to the other FGFRs. When transfected into COS cells, FGFR-4 is the only FGFR that induces membrane ruffling, indicative of cytoskeletal reorganization.44 Originally reported to constitute a specific high-affinity receptor for FGF-1,45 FGFR-4 activation is prolonged compared with FGFR-1, and there is only weak tyrosine phosphorylation of intracellular proteins, including mitogen-activated protein kinase.46 47 Ligand binding has been reported to activate a unique 85-kDa protein with serine/threonine phosphorylation activity.48 Some of these characteristics were also seen in the studies performed here. FGF-19 binding led to delayed but prolonged receptor activation, with tyrosine phosphorylation still observed after 45 minutes. By comparison, FGFR-1, present in photoreceptors, is rapidly (within 30 seconds) activated by FGF-2 and deactivates within 5 to 10 minutes.16 18 In the studies performed here, immunoprecipitation of FGF-19-stimulated cells and immunoblotting with phosphotyrosine antibody revealed a band of approximately 80 kDa, which may represent the associated intracellular signaling protein or an isoform of FGFR-4 itself. Interestingly, we observed coimmunoprecipitation of FGFR-1 and FGFR-4 after FGF-19 stimulation of cultured cells. Immunoblotting for FGFR-1 in FGFR-4-immunoprecipitated material detected a single band at approximately 110 kDa, in accordance with one of the FGFR-1 isoforms observed in previous studies of the retina.18 The intensity of this band varied, depending on the duration of FGF-19 stimulation; it was maximal after 15 minutes, indicating that the formation of FGFR-1/FGFR-4 heterodimers increased after receptor activation. To the best of our knowledge, this is the first time dimerization between these two receptors has been identified. Our previous studies indicate that photoreceptors contain mainly FGFR-1 and FGFR-4 in approximately equal concentrations.19 20 22 It is, hence, plausible that the two forms interact physically on ligand binding. However, we have no formal proof that FGF-19 uniquely activates FGFR-4, as has been reported under cell-free conditions.26 Cellular context is very important in determining receptor-binding interactions, and these parameters have not been examined in detail within the retina. Finally, very recent studies demonstrate the existence of coreceptors that interact with FGFR-4, termed {alpha}Klotho and βKlotho.49 50 Highly abundant in liver and fat cells, these single-span transmembrane proteins increase FGF-19/FGFR-4 interactions in a heparin-dependent manner, suggesting a complex receptor organization for this factor. It will be of great interest to see whether {alpha}Klotho and βKlotho are expressed in retina.

Data have accumulated to indicate a primary role of FGF-19/FGFR-4 in lipid metabolism and energy storage. Transgenic mice that overexpress FGF-19 exhibit an accelerated metabolism, with decreased adipose tissue.51 FGFR-4 knockout mice show defects in the bile acid synthetic pathway.52 No observations were reported on any retinal changes, but it would obviously be of interest to see whether any of these lines have ocular modifications. FGFR-1–/–/FGFR-4–/– hybrids would be an interesting model to examine, but FGFR-1–/– mice die during gestation from failure of the embryo to implant in the uterus.53 One potential approach would be through the use of specific siRNA to inhibit FGFR transcription. In the studies presented here, FGF-19 and several other tested FGFs showed positive effects on expression levels of Nrl. This rod-specific transcription factor is vital for normal rod differentiation,54 and mutations in the phosphorylation site serine 50 lead to retinitis pigmentosa.55 We chose FGFs known to exhibit elevated binding affinity for FGFR-456 and all (FGF-1, FGF-2, FGF-4, FGF-19) stimulated Nrl levels in retinoblastoma and primary photoreceptors. We also observed an inductive effect by RPE-conditioned medium, which contains at least FGF-257 and FGF-19 (data presented here). Endogenous expression profiles of Nrl differ, depending on the tissue (retinoblastoma, purified photoreceptors, whole retina31 36 ), and the stimulatory effects also differed between the different models (i.e., a 30-kDa isoform was up-regulated in Y-79 cells, whereas an approximately 34-kDa protein was up-regulated in photoreceptors). Nevertheless, this resembles the stimulatory effect recently seen for retinoic acid36 and might indicate a general role for soluble signaling factors and posttranslational control of transcription within rod photoreceptors.

These in vitro data indicate that FGF-19 should be added to the list of other growth factors exhibiting beneficial effects on photoreceptor survival. Within the FGF family itself, these include FGF-1,11 12 FGF-2,11 12 13 14 FGF-5, and FGF-18.19 Advocacy of the FGFs as potential therapeutic approaches to retinal degeneration has declined over recent years because of the potential for such agents to induce neovascularization.58 However, several lines of research have indicated that ocular FGF treatment does not necessarily translate into increased blood vessel growth.59 The capacity of FGF-19 to stimulate blood vessel development has not been reported. FGFR-4 is expressed by some vascular endothelial cells, and its overexpression is associated with different neoplastic tissues.60 Overall, its activation induces only a weak mitogenic response in various lines,45 46 and experimental evidence suggests this difference comes from the structure of the cytoplasmic domain because chimeric receptors with amino terminal FGFR-4 and cytoplasmic terminal FGFR-1 display mitogenic characteristics.46 However, in the present study, FGF-19 was clearly strongly mitogenic for Y-79 retinoblastoma, raising potential concerns over any potential clinical application.


    Acknowledgements
 
The authors thank the British Retinitis Pigmentosa Society for its generous financial support to SS-F and DH.


    Footnotes
 
Supported by the British Retinitis Pigmentosa Society (SSF, DH), National Institutes of Health Grant EY01115, and Foundation Fighting Blindness (AS).

Submitted for publication September 30, 2007; revised December 19, 2007; accepted February 25, 2008.

Disclosure: S. Siffroi-Fernandez, None; M.-P. Felder-Schmittbuhl, None; H. Khanna, None; A. Swaroop, None; D. Hicks, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: David Hicks, Laboratoire de Neurobiologie des Rythmes, CNRS UMR 7168/LC2, Institut des Neurosciences Cellulaires et Intégratives, 5 rue Blaise Pascal, 67084 Cedex, Strasbourg, France; photoreceptor67{at}hotmail.com.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bok D. Contributions of genetics to our understanding of inherited monogenic retinal diseases and age-related macular degeneration. Arch Ophthalmol. 2007;125:160–164.[Abstract/Free Full Text]
  2. Michaelides M, Hardcastle AJ, Hunt DM, Moore AT. Progressive cone and cone-rod dystrophies: phenotypes and underlying molecular genetic basis. Surv Ophthalmol. 2006;51:232–258.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  3. Wenzel A, Grimm C, Samardzija M, Reme CE. Molecular mechanisms of light-induced photoreceptor apoptosis and neuroprotection for retinal degeneration. Prog Retin Eye Res. 2005;24:275–306.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  4. Gupta OP, Brown GC, Brown MM. Age-related macular degeneration: the costs to society and the patient. Curr Opin Ophthalmol. 2007;18:201–205.[Web of Science][Medline][Order article via Infotrieve]
  5. Barnstable CJ, Tombran-Tink J. Molecular mechanisms of neuroprotection in the eye. Adv Exp Med Biol. 2006;572:291–295.[Web of Science][Medline][Order article via Infotrieve]
  6. Chaum E. Retinal neuroprotection by growth factors: a mechanistic perspective. J Cell Biochem. 2003;88:57–75.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  7. Chong NH, Alexander RA, Waters L, Barnett KC, Bird AC, Luthert PJ. Repeated injections of a ciliary neurotrophic factor analogue leading to long-term photoreceptor survival in hereditary retinal degeneration. Invest Ophthalmol Vis Sci. 1999;40:1298–1305.[Abstract/Free Full Text]
  8. Liang FQ, Dejneka NS, Cohen DR, et al. AAV-mediated delivery of ciliary neurotrophic factor prolongs photoreceptor survival in the rhodopsin knockout mouse. Mol Ther. 2001;3:241–248.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  9. Frasson M, Picaud S, Leveillard T, et al. Glial cell line-derived neurotrophic factor induces histologic and functional protection of rod photoreceptors in the rd/rd mouse. Invest Ophthalmol Vis Sci. 1999;40:2724–2734.[Abstract/Free Full Text]
  10. McGee Sanftner LH, Abel H, Hauswirth WW, Flannery JG. Glial cell line derived neurotrophic factor delays photoreceptor degeneration in a transgenic rat model of retinitis pigmentosa. Mol Ther. 2001;4:622–629.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  11. Faktorovich EG, Steinberg RH, Yasumura D, Matthes MT, LaVail MM. Photoreceptor degeneration in inherited retinal dystrophy delayed by basic fibroblast growth factor. Nature. 1990;347:83–86.[CrossRef][Medline][Order article via Infotrieve]
  12. Faktorovich EG, Steinberg RH, Yasumura D, Matthes MT, LaVail MM. Basic fibroblast growth factor and local injury protect photoreceptors from light damage in the rat. J Neurosci. 1992;12:3554–3567.[Abstract]
  13. LaVail MM, Yasumura D, Matthes MT, et al. Protection of mouse photoreceptors by survival factors in retinal degenerations. Invest Ophthalmol Vis Sci. 1998;39:592–602.[Abstract/Free Full Text]
  14. Lau D, McGee LH, Zhou S, et al. Retinal degeneration is slowed in transgenic rats by AAV-mediated delivery of FGF-2. Invest Ophthalmol Vis Sci. 2000;41:3622–3633.[Abstract/Free Full Text]
  15. Hicks D, Courtois Y. Fibroblast growth factor stimulates photoreceptor differentiation in vitro. J Neurosci. 1992;12:2022–2033.[Abstract]
  16. Fontaine V, Kinkl N, Sahel J, Dreyfus H, Hicks D. Survival of purified rat photoreceptors in vitro is stimulated directly by fibroblast growth factor-2. J Neurosci. 1998;18:9662–9672.[Abstract/Free Full Text]
  17. Traverso V, Kinkl N, Grimm L, Sahel J, Hicks D. Basic fibroblast and epidermal growth factors stimulate survival in adult porcine photoreceptor cell cultures. Invest Ophthalmol Vis Sci. 2003;44:4550–4558.[Abstract/Free Full Text]
  18. Kinkl N, Sahel J, Hicks D. Alternate FGF2-ERK1/2 signaling pathways in retinal photoreceptor and glial cells in vitro. J Biol Chem. 2001;276:43871–43878.[Abstract/Free Full Text]
  19. Green ES, Rendahl KG, Zhou S, et al. Two animal models of retinal degeneration are rescued by recombinant adeno-associated virus-mediated production of FGF-5 and FGF-18. Mol Ther. 2001;3:507–515.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  20. Kinkl N, Hageman GS, Sahel JA, Hicks D. Fibroblast growth factor receptor (FGFR) and candidate signaling molecule distribution within rat and human retina. Mol Vis. 2002;8:149–160.[Web of Science][Medline][Order article via Infotrieve]
  21. Kinkl N, Ruiz J, Vecino E, Frasson M, Sahel J, Hicks D. Possible involvement of a fibroblast growth factor 9 (FGF9)-FGF receptor-3-mediated pathway in adult pig retinal ganglion cell survival in vitro. Mol Cell Neurosci. 2003;23:39–53.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  22. Fuhrmann V, Kinkl N, Leveillard T, Sahel J, Hicks D. Fibroblast growth factor receptor 4 (FGFR4) is expressed in adult rat and human retinal photoreceptors and neurons. J Mol Neurosci. 1999;13:187–197.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  23. Siffroi-Fernandez S, Cinaroglu A, Fuhrmann-Panfalone V, et al. Acidic fibroblast growth factor (FGF-1) and FGF receptor 1 signaling in human Y79 retinoblastoma. Arch Ophthalmol. 2005;123:368–376.[Abstract/Free Full Text]
  24. Hecht D, Zimmerman N, Bedford M, Avivi A, Yayon A. Identification of fibroblast growth factor 9 (FGF9) as a high affinity, heparin dependent ligand for FGF receptors 3 and 2 but not for FGF receptors 1 and 4. Growth Factors. 1995;12:223–233.[Web of Science][Medline][Order article via Infotrieve]
  25. Wright TJ, Ladher R, McWhirter J, Murre C, Schoenwolf GC, Mansour SL. Mouse FGF15 is the ortholog of human and chick FGF19, but is not uniquely required for otic induction. Dev Biol. 2004;269:264–275.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  26. Xie MH, Holcomb I, Deuel B, et al. FGF-19, a novel fibroblast growth factor with unique specificity for FGFR4. Cytokine. 1999;11:729–735.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  27. Francisco-Morcillo J, Sanchez-Calderon H, Kawakami Y, Belmonte JC, Hidalgo-Sanchez M, Martin-Partido G. Expression of Fgf19 in the developing chick eye. Brain Res Dev Brain Res. 2005;156:104–109.[CrossRef][Medline][Order article via Infotrieve]
  28. Kurose H, Bito T, Adachi T, Shimizu M, Noji S, Ohuchi H. Expression of fibroblast growth factor 19 (Fgf19) during chicken embryogenesis and eye development, compared with Fgf15 expression in the mouse. Gene Expr Patterns. 2004;4:687–693.[CrossRef][Medline][Order article via Infotrieve]
  29. Kurose H, Okamoto M, Shimizu M, et al. FGF19-FGFR4 signaling elaborates lens induction with the FGF8-L-Maf cascade in the chick embryo. Dev Growth Differ. 2005;47:213–223.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  30. Hicks D, Molday RS. Differential immunogold-dextran labeling of bovine and frog rod and cone cells using monoclonal antibodies against bovine rhodopsin. Exp Eye Res. 1986;42:55–71.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  31. Swain PK, Hicks D, Mears AJ, et al. Multiple phosphorylated isoforms of NRL are expressed in rod photoreceptors. J Biol Chem. 2001;276:36824–36830.[Abstract/Free Full Text]
  32. Ethier SP, Kokeny KE, Ridings JW, Dilts CA. erbB family receptor expression and growth regulation in a newly isolated human breast cancer cell line. Cancer Res. 1996;56:899–907.[Abstract/Free Full Text]
  33. Forster V, Dreyfus H, Hicks D. Adult mammalian retina. Haynes LW eds. The Neuron in Tissue Culture. Methods in Neuroscience, IBRO Handbook Series. ;579–585. Wiley & Sons New York.
  34. Becquet F, Goureau O, Soubrane G, Coscas G, Courtois Y, Hicks D. Superoxide inhibits proliferation and phagocytic internalization of photoreceptor outer segments by bovine retinal pigment epithelium in vitro. Exp Cell Res. 1994;212:374–82.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  35. Malik KJ, Chen CD, Olsen TW. Stability of RNA from the retina and retinal pigment epithelium in a porcine model simulating human eye bank conditions. Invest Ophthalmol Vis Sci. 2003;44:2730–2735.[Abstract/Free Full Text]
  36. Khanna H, Akimoto M, Siffroi-Fernandez S, Friedman JS, Hicks D, Swaroop A. Retinoic acid regulates the expression of photoreceptor transcription factor NRL. J Biol Chem. 2006;281:27327–27334.[Abstract/Free Full Text]
  37. Borenfreund E, Puerner JA. Toxicity determined in vitro by morphological alterations and neutral red absorption. Toxicol Lett. 1985;24:119–124.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  38. Harmer NJ, Pellegrini L, Chirgadze D, Fernandez-Recio J, Blundell TL. The crystal structure of fibroblast growth factor (FGF) 19 reveals novel features of the FGF family and offers a structural basis for its unusual receptor affinity. Biochemistry. 2004;43:629–640.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  39. Nishimura T, Utsunomiya Y, Hoshikawa M, Ohuchi H, Itoh N. Structure and expression of a novel human FGF, FGF-19, expressed in the fetal brain. Biochim Biophys Acta. 1999;1444:148–151.[Medline][Order article via Infotrieve]
  40. Itoh N, Yazaki N, Tagashira S, et al. Rat FGF receptor-4 mRNA in the brain is expressed preferentially in the medial habenular nucleus. Brain Res Mol Brain Res. 1994;21:344–348.[Medline][Order article via Infotrieve]
  41. Cornish EE, Natoli RC, Hendrickson A, Provis JM. Differential distribution of fibroblast growth factor receptors (FGFRs) on foveal cones: FGFR-4 is an early marker of cone photoreceptors. Mol Vis. 2004;10:1–14.[Web of Science][Medline][Order article via Infotrieve]
  42. Cornish EE, Madigan MC, Natoli R, Hales A, Hendrickson AE, Provis JM. Gradients of cone differentiation and FGF expression during development of the foveal depression in macaque retina. Vis Neurosci. 2005;22:447–459.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  43. Zhang L, El-Hodiri HM, Ma HF, et al. Targeted expression of the dominant-negative FGFR4a in the eye using Xrx1A regulatory sequences interferes with normal retinal development. Development. 2003;130:4177–4186.[Abstract/Free Full Text]
  44. Johnston CL, Cox HC, Gomm JJ, Coombes RC. bFGF and aFGF induce membrane ruffling in breast cancer cells but not in normal breast epithelial cells: FGFR-4 involvement. Biochem J. 1995;306:609–616.[Web of Science][Medline][Order article via Infotrieve]
  45. Partanen J, Makela TP, Eerola E, et al. FGFR-4, a novel acidic fibroblast growth factor receptor with a distinct expression pattern. EMBO J. 1991;10:1347–1354.[Web of Science][Medline][Order article via Infotrieve]
  46. Vainikka S, Joukov V, Wennstrom S, Bergman M, Pelicci PG, Alitalo K. Signal transduction by fibroblast growth factor receptor-4 (FGFR-4): comparison with FGFR-1. J Biol Chem. 1994;269:18320–18326.[Abstract/Free Full Text]
  47. Wang JK, Gao G, Goldfarb M. Fibroblast growth factor receptors have different signaling and mitogenic potentials. Mol Cell Biol. 1994;14:181–188.[Abstract/Free Full Text]
  48. Vainikka S, Joukov V, Klint P, Alitalo K. Association of a 85-kDa serine kinase with activated fibroblast growth factor receptor-4. J Biol Chem. 1996;271:1270–1273.[Abstract/Free Full Text]
  49. Wu X, Ge H, Gupte J, et al. Co-receptor requirements for fibroblast growth factor-19 signaling. J Biol Chem. 2007;282:29069–29072.[Abstract/Free Full Text]
  50. Kurosu H, Choi M, Ogawa Y, et al. Tissue-specific expression of βklotho and fibroblast growth factor (FGF) receptor isoforms determines metabolic activity of FGF19 and FGF21. J Biol Chem. 2007;282:26687–26695.[Abstract/Free Full Text]
  51. Tomlinson E, Fu L, John L, et al. Transgenic mice expressing human fibroblast growth factor-19 display increased metabolic rate and decreased adiposity. Endocrinology. 2002;143:1741–1747.[Abstract/Free Full Text]
  52. Yu C, Wang F, Kan M, et al. Elevated cholesterol metabolism and bile acid synthesis in mice lacking membrane tyrosine kinase receptor FGFR4. J Biol Chem. 2000;275:15482–15489.[Abstract/Free Full Text]
  53. Deng CX, Wynshaw-Boris A, Shen MM, Daugherty C, Ornitz DM, Leder P. Murine FGFR-1 is required for early postimplantation growth and axial organization. Genes Dev. 1994;8:3045–3057.[Abstract/Free Full Text]
  54. Mears AJ, Kondo M, Swain PK, et al. Nrl is required for rod photoreceptor development. Nat Genet. 2001;29:447–452.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  55. Swain P, Kumar S, Patel D, et al. Mutations associated with retinopathies alter mitogen-activated protein kinase-induced phosphorylation of neural retina leucine-zipper. Mol Vis. 2007;13:1114–1120.[Web of Science][Medline][Order article via Infotrieve]
  56. Ornitz DM, Xu J, Colvin JS, et al. Receptor specificity of the fibroblast growth factor family. J Biol Chem. 1996;271:15292–15297.[Abstract/Free Full Text]
  57. Schweigerer L, Malerstein B, Neufeld G, Gospodarowicz D. Basic fibroblast growth factor is synthesized in cultured retinal pigment epithelial cells. Biochem Biophys Res Commun. 1987;143:934–940.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  58. Schultz GS, Grant MB. Neovascular growth factors. Eye. 1991;5:170–180.[Medline][Order article via Infotrieve]
  59. Ozaki H, Okamoto N, Ortega S, et al. Basic fibroblast growth factor is neither necessary nor sufficient for the development of retinal neovascularization. Am J Pathol. 1998;153:757–765.[Abstract/Free Full Text]
  60. Shin EY, Lee BH, Yang JH, et al. Up-regulation and co-expression of fibroblast growth factor receptors in human gastric cancer. J Cancer Res Clin Oncol. 2000;126:519–528.[CrossRef][Web of Science][Medline][Order article via Infotrieve]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Siffroi-Fernandez, S.
Right arrow Articles by Hicks, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Siffroi-Fernandez, S.
Right arrow Articles by Hicks, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS