Originally published In Press as
doi:10.1167/iovs.08-1811 on May 9, 2008
(Investigative Ophthalmology and Visual Science. 2008;49:3360-3370.)
© 2008 by The Association for Research in Vision and Ophthalmology, Inc.
doi:10.1167/iovs.08-1811
Identification of Candidate Klf4 Target Genes Reveals the Molecular Basis of the Diverse Regulatory Roles of Klf4 in the Mouse Cornea
Shivalingappa K. Swamynathan,1,2
Janine Davis,2 and
Joram Piatigorsky2
1From the University of Pittsburgh School of Medicine, Department of Ophthalmology, Pittsburgh, Pennsylvania; and the
2Laboratory of Molecular and Developmental Biology, National Eye Institute, National Institutes of Health, Bethesda, Maryland.
 |
Abstract
|
|---|
PURPOSE. Krüppel-like factor 4 (Klf4) plays a crucial role in the development and maintenance of the mouse cornea. In the current study, wild-type (WT) and Klf4-conditional null (Klf4CN) corneal gene expression patterns were examined, to gain understanding of the molecular basis of the Klf4CN corneal phenotype.
METHODS. Expression of more than 22,000 genes in 10 WT and Klf4CN corneas was compared by microarrays, analyzed using BRB ArrayTools (National Cancer Institute, Bethesda, MD) and validated by Q-RT-PCR. Transient cotransfections were used to test whether Klf4 activates the aquaporin-3, Aldh3a1, and TKT promoters.
RESULTS. Scatterplot analysis identified 740 and 529 genes up- and downregulated by more than twofold, respectively, in the Klf4CN corneas. Cell cycle activators were upregulated, whereas the inhibitors were downregulated, consistent with the increased Klf4CN corneal epithelial cell proliferation. Desmosomal components were downregulated, consistent with the Klf4CN corneal epithelial fragility. Downregulation of aquaporin-3, detected by microarray, was confirmed by immunoblot and immunohistochemistry. Aquaporin-3 promoter activity was stimulated 7- to 10-fold by cotransfection with pCI-Klf4. The corneal crystallins Aldh3A1 and TKT were downregulated in the Klf4CN cornea, and their respective promoter activities were upregulated 16- and 9-fold by pCI-Klf4 in cotransfections. The expression of epidermal keratinocyte differentiation markers was affected in the Klf4CN cornea. Although the cornea-specific keratin-12 was downregulated, most other keratins were upregulated, suggesting hyperkeratosis.
CONCLUSIONS. Functionally diverse candidate Klf4 target genes were identified, revealing the molecular basis of the diverse aspects of the Klf4CN corneal phenotype. These results establish Klf4 as an important node in the genetic network of transcription factors regulating the corneal homeostasis.
Clear vision requires proper development and maintenance of the cornea, a multilayered tissue comprising an outer stratified squamous epithelium, an inner monolayered endothelium and a central stroma with regularly arranged collagen lamellae sparsely populated by keratocytes. The molecular and cellular mechanisms involved in the development and maintenance of the transparence, refractive, and barrier functions of the cornea are exquisitely regulated.1 2 3 4 5 6 7 8 Defective development and maintenance of the cornea result in severe defects in vision.9 10 Different transcription factors influencing corneal morphogenesis and their target genes are known.11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Despite these advances, our knowledge of the genetic network of transcription factors regulating embryonic morphogenesis, postnatal maturation, and maintenance of cornea remains incomplete.
Klf4, a member of the Krüppel-like transcription factors (Klf) subfamily of Cys2-His2 zinc finger proteins capable of binding the "GT box" or "CACCC" element, is one of the most highly expressed transcription factors in both 9-day- and 6-week-old mouse corneas.20 26 27 28 29 During development, the expression of Klf4 begins in a stripe of mesenchymal cells extending from the forelimb bud to the developing eye at approximately embryonic day (E)10.30 In the adult mouse, Klf4 is widely expressed in postmitotic epithelia of diverse tissues, including skin, gastrointestinal tract, and cornea.27 31 32 Klf4-null mice die within 15 hours after birth because of late-stage defects in skin barrier formation.33 Klf4-conditional null (Klf4CN) corneas, derived by mating Klf4-LoxP mice34 with Le-Cre mice,17 35 have multiple ocular defects, including corneal epithelial fragility, stromal edema, smaller, vacuolated lens, and loss of conjunctival goblet cells.36 To investigate the changes in gene expression underlying the Klf4CN corneal phenotype, we have compared the gene expression patterns of the wild-type (WT) and Klf4CN corneas by microarray hybridization in the present report. Our results show that Klf4 plays a significant role in the maintenance of corneal homeostasis by regulating a wide array of genes encompassing a diverse spectrum of functional subgroups, such as regulators of cell proliferation, cell adhesion molecules, corneal crystallins, components of epithelial barrier function, and regulators of stromal hydration.
 |
Materials and Methods
|
|---|
Conditional Deletion of Klf4
Klf4CN mice were generated on a mixed background by mating Klf4loxP/loxP, Le-Cre/– mice with Klf4loxP/loxP mice as described before.34 35 36 This mating scheme generated equal numbers of Klf4loxP/loxP, Le-Cre/– (Klf4CN), and Klf4loxP/loxP (control) offspring. Genomic DNA isolated from tail clippings was assayed for the presence of the Klf4-LoxP and Le-Cre transgenes by PCR using specific primers. The mice in the present study were maintained in accordance with the guidelines set forth by the Animal Care and Use Committee of the National Eye Institute, National Institutes of Health, and the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.
Isolation of Total RNA, Quality Control, Labeling, and Microarray Analysis
In the present analysis, we used the whole cornea, comprising epithelial cells, stromal keratocytes, and endothelial cells, as well as a small number of infiltrating leukocytes. Similar microarray analyses of whole corneas have been useful in identifying the corneal responses to Aspergillus fumigatus37 or Pseudomonas aeruginosa38 infections and diabetic conditions39 and in characterizing the healing process after laser ablation40 or keratectomy.41 Five age-matched, 8-week-old WT and Klf4CN mice each were used for comparison of corneal gene expression by microarray analysis. Two dissected corneas from each mouse were combined for isolation of total RNA (RNeasy Mini kit; Qiagen, Valencia, CA). The RNA was sent to Expression Analysis (Durham, NC) which confirmed the integrity of the isolated total RNA by using a bioanalyzer (Agilent Technologies, Palo Alto, CA) (Supplementary Fig. S1, online at http://www.iovs.org/cgi/content/full/49/8/3360/DC1) and subsequently performed the microarray hybridizations. Labeled samples were hybridized with mouse gene arrays (Mouse 430 2.0; Affymetrix, Santa Clara, CA) containing 45,101 panels, each targeting a specific nucleic acid sequence. In these arrays, approximately 22,000 transcripts identified by Entrez Gene numbers (Entrez Database; National Center for Biotechnology Information, Bethesda, MD, available at www.ncbi.nlm.nih.gov/sites/entrez) are redundantly targeted by 41,400 panels: The remaining panels target relatively less-characterized sequences. The raw data obtained from Expression Analysis was analyzed using BRB-ArrayTools software (developed by Richard Simon and Amy Peng Lamthe, Biometric Research Branch, National Cancer Institute, Bethesda, MD, available at linus.nci.nih.gov/brb-arraytools.html/). Microarray data were normalized by using median over entire array and filtered according to the following criteria: The genes were excluded from analysis if (1) the probability was greater than 0.005, (2) the percentage of data missing or filtered out were greater than 50%, (3) greater than 20% of expression data showed more than a 1.5-fold change in either direction from the median value, or (4) the detection call was "absent" in more than 50% in both WT and Klf4CN. The microarray results provided in this report are log transformed.
Validation of Microarray Results Using RT-PCR and Real-Time Quantitative RT-PCR
Total RNA isolated from the WT or Klf4CN corneas was quantified, the concentration adjusted with RNase-free water to 100 ng/µL, and one-step RT-PCR performed with 100 ng total RNA and RT-PCR beads (Ready-To-Go; GE Healthcare, Piscataway, NJ). To distinguish the products amplified from the contaminating genomic DNA if any, from those originating from the mRNA, the forward and reverse primers used in RT-PCR were chosen from adjacent exons. The sequence of primers used for RT-PCR is provided in Supplementary Table S1, online at http://www.iovs.org/cgi/content/full/49/8/3360/DC1. The RT-PCR products were separated on a 1.5% agarose gel with TBE buffer.
Applied Biosystems, Inc. ([ABI], Foster City, CA) was the source of the reagents, equipment, and software for gene expression quantitative real-time RT-PCR assays (Q-RT-PCR; TaqMan; ABI). cDNA was generated (High Capacity cDNA Archive Kit; ABI), and total RNA was isolated from pooled corneas of 10 WT or Klf4CN mice. Q-RT-PCR assays with prestandardized gene-specific probes for different transcripts were performed in a thermocycler (model 7900HT; ABI), with 18S rRNA as the endogenous control; the results were analyzed with commercial software (SDS software ver. 2.1; ABI).
Immunoblots and Immunohistochemistry
Total protein was extracted by homogenizing dissected corneas in 8.0 M urea, 0.08% Triton X-100, 0.2% sodium dodecyl sulfate, 3% β-mercaptoethanol, and proteinase inhibitors and was quantified by the bicinchoninic acid method (Pierce, Rockford, IL). Equal amounts of protein were electrophoresed in sodium dodecyl sulfate-polyacrylamide gels, transferred to polyvinylidene difluoride membranes and subjected to immunoblot analysis. Rabbit anti-aquaporin-3 (Calbiochem, La Jolla, CA), and anti-actin antibody (Sigma-Aldrich, St. Louis, MO) were used as primary antibodies at a 1:1000 dilution in PBST. Horseradish peroxidase-coupled anti-rabbit immunoglobulin G (GE Healthcare, Piscataway, NJ) was used as a secondary antibody at a 1:5000 dilution. Immunoreactive bands were visualized by chemiluminescence (Super Signal West Pico solutions; Pierce).
For immunohistochemistry, 10-µm-thick cryosections from OCT-embedded eyeballs were fixed in freshly prepared, buffered 4% paraformaldehyde for 30 minutes, blocked with 10% sheep serum in PBST for 1 hour at room temperature in a humidified chamber, washed twice with PBST for 5 minutes each, incubated with a 1:100 dilution of the primary antibody for 1 hour at room temperature, washed thrice with PBST for 10 minutes each, incubated with secondary antibody (AlexaFluor 555-coupled goat anti-rabbit IgG antibody; Invitrogen-Molecular Probes, Carlsbad, CA) at a 1:300 dilution for 1 hour at room temperature, washed thrice with PBST for 10 minutes each, mounted with antifade reagent with DAPI (Prolong Gold; Molecular Probes), and observed with a fluorescence microscope (Axioplan 2; Carl Zeiss Meditec, Dublin, CA).
Reporter Vectors, Cell Culture, and Promoter Activities
Mouse genomic DNA was used to amplify different promoter fragments used in the cotransfection assays reported herein. Aquaporin3 (Aqp3) –502/+42- and –262/+42-bp promoter fragments were amplified by using the downstream Aqp3 +42/+22C HindIII (+42 ATGCAAGCTTGTCCGGCGGCGTACGAGTGC +22C) and upstream Aqp3 –502/–482 XhoI (–502 ATGCCTCGAGCACGAAGCGCTGGTGAATTC –482) or Aqp3 –262/–245 XhoI (–262 ATGCCTCGAGGGAGACCGCTTGCTCTTC –245) primers. Transketolase (TKT) –518/+104-bp promoter fragment was amplified by using upstream TKT –518/–491 KpnI (–518 GGCCGGTACCGGCAAACCCAGTAATCTC –491) and downstream TKT +104/+87-bp HindIII (+104 GGCCAAGCTTCCTTCCATGGCGTGGTAGG +87) primers. Aldh3a1 –1050/+3486-bp promoter fragment was isolated as described previously.42 These promoter fragments were cloned upstream of the luciferase reporter gene in a vector (pGL3Basic; Promega, Madison, WI) to generate the reporter vectors. Full-length Klf4 was transiently expressed by using the CMV promoter in pCI-Klf4. Monkey kidney Cos7 cells were grown in Dulbeccos modified Eagles medium (DMEM) supplemented with 10% fetal bovine serum, penicillin, and streptomycin at 37°C in a humidified chamber containing 5% CO2 and 95% air. Simian virus SV40-transformed human corneal epithelial (HCE) cells43 were grown at 37°C in Hams F-12 supplemented with 10% fetal bovine serum, 0.5% (vol/vol) dimethyl sulfoxide, cholera toxin (0.1 µg/mL), epidermal growth factor (10 ng/mL), insulin (5 µg/mL), gentamicin (40 µg/mL), and glutamine (20 mM) in a humidified chamber containing 5% CO2 and 95% air. Mid-log phase cells in six-well plates were transfected with 0.5 µg of pAldh3A1-Luc, pTKT-Luc, or pAqp3-Luc, along with 10 ng pRL-SV40, for normalization of transfection efficiency (Promega), and 0.5 µg of pCI or pCI-Klf4, using 3 µL of transfection reagent (Fugene 6; Roche Molecular Biochemicals, Indianapolis, IN). After 2 days, the cells were washed with cold PBS and lysed with 500 µL passive lysis buffer (Promega). The lysate was clarified by centrifugation and 50 µg protein in the lysate was analyzed with a dual-luciferase assay kit (Promega) and a microplate luminometer (Victor; Perkin-Elmer, Wellesley, MA). The measurement was integrated over 10 seconds with a delay of 2 seconds. Results from at least three independent experiments, normalized for transfection efficiency using the SV40 promoter-driven Renilla luciferase activity, were used to obtain mean promoter activities and standard deviation. Activation (x-fold multiples of change) was determined by dividing mean promoter activity by the promoter activity without added pCI/pCI-Klf4.
 |
Results
|
|---|
Microarray Analysis and Validation of Results
To obtain mechanistic insight into the diverse ocular surface phenotype observed in the Klf4CN mice,36 we compared the gene expression patterns between the WT and Klf4CN corneas by microarray hybridization. Scatterplot analysis of the 6333 genes that passed the filtering criteria described in Materials and Methods showed that 529 genes were downregulated and 740 genes were upregulated by more than twofold in the Klf4CN compared with the WT corneas (Fig. 1 , Supplementary Tables S2A, S2B, online at http://www.iovs.org/cgi/content/full/49/8/3360/DC1). Microarray results were validated by quantitative real-time RT-PCR comparison of expression levels of 19 genes (Table 1) . There was a general conformity between the microarray and Q-RT-PCR results, indicating that the microarray results reflect the extent of changes in gene expression in the Klf4CN corneas (Table 1) . The candidate Klf4 target genes, whose expression was significantly affected in the Klf4CN corneas, fall into different functional subgroups regulating diverse functions such as cell proliferation, apoptosis, development, immune response, and barrier function. Below, we have analyzed the microarray results further, to correlate different aspects of the Klf4CN corneal phenotype with specific changes in gene expression, thus revealing the diverse contributions of Klf4 to corneal physiology.

View larger version (65K):
[in this window]
[in a new window]
|
FIGURE 1. Scatterplot analysis of 6333 genes passing the filter described in Materials and Methods. Expression of 529 genes was downregulated and 740 genes upregulated by more than twofold in Klf4CN compared with the WT corneas. The expression of approximately 80% of the genes (5064 genes) passing the filter remained relatively stable with less than twofold change.
|
|
Role of Klf4 in Regulating the Progression of Corneal Epithelial Cell Cycle
In view of the increased rate of Klf4CN corneal epithelial cell proliferation,36 we examined the expression pattern of a subset of genes known to participate in or regulate cell cycle. Several cell proliferation activators were upregulated while cell cycle suppressors were downregulated in the Klf4CN cornea, compared to the WT (Table 2) . Important activators of the cell cycle that were upregulated include cyclin D2, cyclin-dependent kinase 6, receptor type protein tyrosine phosphatase-b and -c, and FMS-like tyrosine kinase-1. Significantly downregulated inhibitors of cell cycle include retinoblastoma-1 (Rb) and cyclin-dependent kinase inhibitor 1a (p21). The upregulation of activators of the cell cycle and the downregulation of inhibitors of the cell cycle are consistent with the increased cell proliferation in the Klf4CN corneal epithelium.36
Role of Klf4 in Regulation of Epithelial Cell–Cell Adhesion
Despite the increased rate of cell proliferation, the Klf4CN cornea possessed fewer epithelial cell layers than the WT, suggesting reduced cell–cell adhesion at the Klf4CN ocular surface.36 To explore this possibility further, we examined the expression of different components of desmosomes, the intercellular adhesion complexes prevalent in the stratified epithelia.44 The expression of most of the desmosomal components was significantly downregulated in the Klf4CN cornea, strongly supporting the notion that compromised cell–cell adhesion is responsible for the reduced numbers of Klf4CN corneal epithelial cell layers (Fig. 2A) . Comparison of expression of these desmosomal components in the WT and Klf4CN corneas by RT-PCR validated the microarray results (Fig. 2B) .

View larger version (25K):
[in this window]
[in a new window]
|
FIGURE 2. (A) Expression levels of different desmosomal components in the WT and Klf4CN corneas as detected by microarray. The values shown are log transformed. (B) Validation of downregulation of genes encoding desmosomal components in the Klf4CN (CN) compared with the WT corneas, by RT-PCR. M, molecular weight markers.
|
|
Role of Klf4 in Regulation of Corneal Hydration
Aquaporin-1, -3, and -5 are responsible for keeping the hydrophilic corneal stroma from abnormal swelling.45 46 We have reported that the downregulation of Aqp5 may be responsible for the Klf4CN corneal stromal edema.36 In addition to confirming the downregulation of Aqp5, the present microarray analysis revealed that the expression of Aqp3 also is reduced in the Klf4CN cornea to approximately half that in the WT, whereas the expression of Aqp1 remains relatively unaffected. Downregulation of Aqp3 transcripts and the 38-kDa Aqp3 protein was validated by Q-RT-PCR (Table 1 ; Fig. 3A ) and immunoblot analysis (Fig. 3B) , respectively. Equal loading ofproteins for immunoblot analysis was confirmed by stripping the membrane of antibodies and reprobing with an anti-actin antibody, which did not show any difference between WT and Klf4CN corneas (Fig. 3B) . Immunohistochemistry confirmed the reduction in the amount of Aqp3 in the Klf4CN corneal epithelium (Fig. 3C) consistent with the reduced amount of Aqp3 in the Klf4CN corneal extracts compared with the WT extracts (Fig. 3B) . In view of the reduced stratification of the Klf4CN corneal epithelium (Fig. 3C) , it was uncertain to what extent the reduced Aqp3 protein band in the immunoblot (Fig. 3B) was due to reduced expression of Aqp3 in the epithelium or to the relatively large stromal cell representation in the Klf4CN corneal extracts inasmuch as stromal cells do not express Aqp3 (present study and Refs. 47 48 ), yet contain actin which was used for normalization. To test more directly whether Klf4 stimulates Aqp3 promoter activity, we used cotransfection assays in cultured cells. Both –502/+42- and –262/+42-bp Aqp3 promoter activities were upregulated 8- to 9-fold by cotransfection with pCI-Klf4, indicating that the activating sites reside within the –262/+42-bp region of the Aqp3 proximal promoter (Fig. 3D) . Taken together, these results show that the Aqp3 promoter is regulated by Klf4 and suggest that the cumulative effect of the reduced expression of Aqp3 and Aqp5 is responsible for the observed Klf4CN stromal edema.36

View larger version (23K):
[in this window]
[in a new window]
|
FIGURE 3. Aquaporin-3 expression was reduced in the Klf4CN relative to the WT cornea. (A) Q-RT-PCR comparison of expression levels of Aqp3 in the WT and Klf4CN corneas. (B) Immunoblot analysis of Aqp3 levels in total proteins extracted from WT and Klf4CN corneas. The blot probed with anti-Aqp3 antibody (left) was stripped of the antibody and reprobed with anti-actin antibody (right) to ensure equal loading of proteins. (C) Immunohistochemistry with anti-Aqp3 antibody. Images show (top row) nuclei stained with DAPI (bottom row) fluorescence coming from the secondary antibody bound to the primary anti-Aqp3 antibody. The expression of Aqp3 localized to the epithelial and endothelial cell membranes in the WT (bottom, left) was reduced in the Klf4CN cornea (bottom, center). The sections processed in a similar manner without the primary antibody served as controls (bottom, right). (D) Aquaporin-3 promoter was stimulated by KLF4 in cultured human corneal epithelial cells cotransfected with Aqp3-Luc and pCI-Klf4.
|
|
Role of Klf4 in the Regulation of Corneal Crystallins
Corneas, like lenses, accumulate unusually high proportions of a few water-soluble proteins termed corneal crystallins, in a taxon-specific manner.49 In the mouse corneal epithelium, aldehyde dehydrogenase-3a1 (Aldh3a1) and transketolase (TKT) comprise 20% to 50% and 10% to 15%, respectively, of the water-soluble protein.50 51 Microarray comparisons indicated that the expression of Aldh3a1 and TKT genes was downregulated in the Klf4CN cornea to 90% and 30% of the WT, respectively (Fig. 4A) . This downregulation was estimated more quantitatively by Q-RT-PCR, which showed that the expression of Aldh3a1 and TKT genes in the Klf4CN cornea was downregulated to 41% and 56% of the WT, respectively (Fig. 4B) . To test directly the influence of Klf4 on Aldh3A1 and TKT promoter activities, we used cotransfection assays in cultured Cos7 cells, in which the –1050/+3486-bp Aldh3A1 promoter and –518/+104-bp TKT promoter activities were upregulated by 16- and 9-fold, respectively, in cells cotransfected with pCI-Klf4, compared to those cotransfected with pCI (Fig. 4C) . Taken together, these results suggest that Klf4 contributes to the corneal transparence and refractive properties, by activating the expression of corneal crystallins Aldh3A1 and TKT.

View larger version (19K):
[in this window]
[in a new window]
|
FIGURE 4. Expression of corneal crystallins Aldh3a1 and TKT was regulated by Klf4. (A) Comparison of expression of Aldh3a1 and TKT in the WT and Klf4CN cornea, as detected by microarray. (B) Q-RT-PCR comparison of expression of Aldh3a1 and TKT in WT and Klf4CN corneas. (C) Aldh3a1 and TKT promoter activities are stimulated by Klf4 in Cos-7 cells on cotransfection with pCI-Klf4.
|
|
Role of Klf4 in Regulating the Barrier Function of Corneal Epithelium
Several genes encoding proteins related directly or indirectly to epithelial barrier function were downregulated in the Klf4CN cornea. Uroplakin 3B, an integral membrane protein that contributes to the apical membrane permeability barrier function,52 as well as gastrokine-1 (also known as antrum mucosal protein-18), a mitogenic protein abundantly expressed in the superficial gastric epithelium and downregulated in gastric carcinoma,53 were significantly downregulated in the Klf4CN cornea (Supplementary Table S2B). The expression of a large number of immune response-related genes was affected in the Klf4CN cornea (Supplementary Tables S2A, S2B). The upregulated immune response–related genes belonged to diverse groups, such as complement components, chemokines, and chemokine receptors. Infiltration of the immune cells into the Klf4CN cornea in response to the inflammatory signals generated by the fragile corneal epithelium and edematous stroma may account for the observed upregulation of the immune response–related genes in the Klf4CN cornea.
Keratins, the fibrous intermediate-filament protein polymers, play critical roles in maintenance of the epithelial cell structure, protecting them from mechanical trauma. We have shown that Krt12 promoter is bound and upregulated by Klf4 and that the downregulation of Krt12 may be responsible for the Klf4CN corneal epithelial fragility.36 Microarray analysis showed that while Krt12 was indeed downregulated, most of the other keratins were upregulated, indicating hyperkeratosis in the Klf4CN cornea (Fig. 5A) . RT-PCR assays validated these microarray results (Fig. 5B) .

View larger version (35K):
[in this window]
[in a new window]
|
FIGURE 5. (A) Expression levels of different keratins in the WT and Klf4CN corneas as detected by microarray. The values shown are log transformed. (B) Validation of upregulation of genes encoding different keratin genes in the Klf4CN (CN) compared with the WT corneas, by RT-PCR. M, molecular weight markers.
|
|
Role of Klf4 in Regulation of Genes Involved in Mouse Epidermal Keratinocyte Differentiation
In view of the fact that Klf4 plays a crucial role in the mouse epidermal development,33 we examined the expression pattern of different genes involved in the mouse epidermal keratinocyte differentiation. Oncogenes Ets1 and Jun, as well as tumor necrosis factor receptor Tnfrsf1b, were upregulated, whereas the expression of epidermal growth factor (egf), protein kinase-Cβ1, and mitogen-activated protein kinase kinase-6 (Mapkk6) were downregulated by more than twofold in the Klf4CN cornea, compared with the WT (Supplementary Table S2A; Table 3 ). Expression of epidermal keratinocyte differentiation markers, such as involucrin and transglutaminase was affected in the Klf4CN cornea. Expression of several members of the Sprr family of proteins, constituents of the cornified envelope in the skin, was upregulated in the Klf4CN cornea (Supplementary Table S2A; Table 3 ).
Role of Klf4 in the Regulation of Gene Regulatory Networks in the Cornea
To understand the impact of conditional deletion of Klf4 on gene regulatory networks in the cornea, we examined the expression levels of different transcription factors in the Klf4CN cornea. Downregulation of the paired box–homeobox transcription factor Pax6, central to eye development,54 by more than twofold, as detected by microarray analysis (Table 4) , was validated by Q-RT-PCR (Table 1) . In addition, the special AT-rich sequence-binding protein-1 (SATB1), which organizes nuclear architecture and recruits chromatin remodeling factors to specific promoters,55 56 57 was downregulated by approximately threefold (Table 4) . Another significantly downregulated transcription factor, inhibitor of DNA binding-2 (Id2), is known to contribute to epithelial cell differentiation and suppress tumor formation.58 In contrast, several stress response–related transcription factors, such as Ahr,59 E2F5 and EGR1,60 NF
B2,61 and ATF362 were significantly upregulated in the Klf4CN cornea, compared with the WT cornea (Table 4) .
 |
Discussion
|
|---|
Previously, we demonstrated that the structural integrity of the mouse corneal epithelium, stroma, and endothelium was affected when the Klf4 gene was deleted, indicating that Klf4 plays a crucial role in the development and maintenance of the mouse cornea.36 We also demonstrated that the expression levels of Krt12 and Aqp5 are reduced in the Klf4CN cornea, consistent with the Klf4CN corneal epithelial fragility and stromal edema, respectively. Here, we have used microarray analysis to obtain a comprehensive view of the changes in corneal gene expression on deletion of Klf4. Our findings reveal the molecular basis of the wide-ranging influence of Klf4 on corneal homeostasis and identify candidate target genes of Klf4 in the adult mouse cornea.
Previous attempts at Klf4 target gene profiling used a human cell line containing inducible Klf4,63 64 or transgenic mice overexpressing Klf4 in the epidermis under the control of keratin-5 promoter (Krt5-Klf4) and the Klf4–/– mice.65 In addition to being largely consistent with the earlier reports, our results identify novel Klf4 target genes with specialized functions in the mouse cornea, such as aquaporins-3 and -5, the corneal crystallins Aldh3a1 and transketolase, and desmosomal components.
Consistent with the established mechanism of suppression of cell proliferation by Klf4,66 67 cyclin-D2 was upregulated and cdkn1a (p21) was downregulated in the Klf4CN cornea. Furthermore, our results are consistent with those in a previous report that showed several other inhibitors of cell division to be upregulated, and activators of cell cycle to be downregulated by Klf4,64 suggesting additional mechanisms by which Klf4 can suppress the progression of cell cycle (Tables 2A 2B) .
Many members of the large family of keratins, the major components of the intermediate filaments protecting the epithelial cells from mechanical and nonmechanical stresses,68 are upregulated in the Klf4CN corneas. In contrast to our results, most keratins were upregulated by Klf4 in a Klf4-inducible cell culture system.63 This difference could be due to the different experimental systems used and/or to an indirect hyperkeratinizing response in the Klf4CN cornea, as a consequence of the loss of corneal barrier function.
A striking feature of our results is the large number of genes whose expression is affected by the absence of Klf4 in the mouse cornea. Although some of these genes are likely to be direct targets of Klf4, the remaining genes may be indirect targets through other transcription factors regulated by Klf4. The expression of Pax6 is reduced to about half in the Klf4CN cornea compared to the WT cornea. Thus, Pax6 target genes are likely to be included in the list of genes affected by the absence of Klf4. In this regard, it is noteworthy that the Pax6+/– corneal epithelium appears remarkably similar to the Klf4CN corneal epithelium, with fewer cell layers, roughened ocular surface, and epithelial vacuolation.15 69 Other transcription factors with reduced (Id2, SATB1, and Elk4) or increased (NF
B, Sox4, Atf3, C/EBP
. GATA2, Ahr and Egr1) expression in the Klf4CN cornea may indirectly contribute to the list of genes with changed expression in the Klf4CN cornea.
In addition to these changes, the expression of many genes with no established functions in the cornea and/or no apparent relevance to the Klf4CN corneal phenotype was significantly affected in the Klf4CN cornea. Three members of the Ly6/Plaur domain containing the proteins Slurp1, one of the most abundant transcripts in the mouse cornea,27 a ligand for nicotinic acetylcholine receptors and a late marker of epidermal differentiation associated with the inflammatory palmoplantar keratoderma disease Mal de Meleda70 71 72 ; Lynx1 (also a ligand for nicotinic acetylcholine receptors73 ); and Lypd2 were significantly downregulated in the Klf4CN cornea (Supplementary Table S2B). Similarly, the expression of 15 and 9 different members of the solute carrier family of proteins was up- and downregulated respectively, in the Klf4CN compared with the WT cornea (Supplementary Tables S2A, S2B). Whether these changes contribute to any aspect of the Klf4CN corneal phenotype remains to be established.
The results presented in this report show that Klf4 coordinately regulates functionally related subsets of genes, such as those contributing to the control of corneal epithelial cell cycle progression, intercellular adhesion, corneal crystallins, the Ly6/Plaur domain containing proteins Slurp1, Lypd2, and Lynx1,70 71 72 73 and the small proline-rich proteins (SPRR), the primary constituents of the cornified cell envelope and integral components of the surface barrier.74 75 We have also shown that Klf4 stimulates the promoter activities of aquaporin-3 and -5,36 and corneal crystallins Aldh3A1 and TKT in cultured cells. It remains to be established whether Klf4 plays a direct role in the coordinate regulation of the remaining groups of genes whose expression is affected in the Klf4CN cornea. A fraction of the observed changes in gene expression could be indirect, such as a response to the inflammatory conditions caused by the fragile Klf4CN corneal epithelium. The loss of epithelial barrier function may be responsible for the overexpression of several stress-related genes in the Klf4CN cornea, such as the antioxidant enzyme ceruloplasmin, which is upregulated in different neurodegenerative disorders including glaucoma76 77 ; arachidonate lipoxygenase-12 and -15, which promote epithelial wound healing and host defense78 ; and carbonic anhydrase-2, -12, and -13, regulators of corneal ion transport, that are overexpressed in human glaucoma79 80 (Supplementary Tables S2A, S2B).
In summary, the changes in gene expression patterns detected by the present microarray analysis are consistent with the phenotypic changes in the Klf4CN cornea. Our results show that Klf4 contributes to corneal homeostasis by coordinately regulating the expression of subsets of genes involved in specific functions such as progression of the cell cycle, cell–cell adhesion, epithelial barrier formation, expression of corneal crystallins, and maintenance of corneal hydration. Taken together with the findings in our earlier report,36 the present studies establish Klf4 as an important component in the genetic network of transcription factors necessary for proper development and maintenance of the ocular surface.
 |
Acknowledgements
|
|---|
The authors thank Stephen Harvey, University of Pittsburgh, for insightful comments on the manuscript.
 |
Footnotes
|
|---|
Supported by the intramural research program of the National Eye Institute, NEI Career Development Award 1 K22 EY016875-01 (SKS), startup funds from the Department of Ophthalmology, Core Grant for Vision Research 5P30 EY08098-19, Research to Prevent Blindness, and the Eye and Ear Foundation, Pittsburgh.
Submitted for publication January 30, 2008; revised March 27, 2008; accepted June 16, 2008.
Disclosure: S.K. Swamynathan, None; J. Davis, None; J. Piatigorsky, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: Shivalingappa K. Swamynathan, Department of Ophthalmology, Eye and Ear Institute, University of Pittsburgh School of Medicine, 203 Lothrop Street, Room 1025, Pittsburgh, PA 15213; swamynathansk{at}upmc.edu.
 |
References
|
|---|
- Hay ED. Development of the vertebrate cornea. Int Rev Cytol. 1979;63:263–322.[Medline][Order article via Infotrieve]
- Zieske JD. Corneal development associated with eyelid opening. Int J Dev Biol. 2004;48:903–911.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Collinson JM, Morris L, Reid AI, et al. Clonal analysis of patterns of growth, stem cell activity, and cell movement during the development and maintenance of the murine corneal epithelium. Dev Dyn. 2002;224:432–440.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Beebe DC, Masters BR. Cell lineage and the differentiation of corneal epithelial cells. Invest Ophthalmol Vis Sci. 1996;37:1815–1825.[Abstract/Free Full Text]
- Lavker RM, Dong G, Cheng SZ, Kudoh K, Cotsarelis G, Sun TT. Relative proliferative rates of limbal and corneal epithelia: implications of corneal epithelial migration, circadian rhythm, and suprabasally located DNA-synthesizing keratinocytes. Invest Ophthalmol Vis Sci. 1991;32:1864–1875.[Abstract/Free Full Text]
- Thoft RA, Friend J. The X, Y, Z hypothesis of corneal epithelial maintenance. Invest Ophthalmol Vis Sci. 1983;24:1442–1443.[Free Full Text]
- Cotsarelis G, Cheng SZ, Dong G, Sun TT, Lavker RM. Existence of slow-cycling limbal epithelial basal cells that can be preferentially stimulated to proliferate: implications on epithelial stem cells. Cell. 1989;57:201–209.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Nagasaki T, Zhao J. Centripetal movement of corneal epithelial cells in the normal adult mouse. Invest Ophthalmol Vis Sci. 2003;44:558–566.[Abstract/Free Full Text]
- Klintworth GK. The molecular genetics of the corneal dystrophies: current status. Front Biosci. 2003;8:d687–d713.[Web of Science][Medline][Order article via Infotrieve]
- Vincent AL, Patel DV, McGhee CN. Inherited corneal disease: the evolving molecular, genetic and imaging revolution. Clin Exp Ophthalmol. 2005;33:303–316.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Adhikary G, Crish JF, Bone F, Gopalakrishnan R, Lass J, Eckert RL. An involucrin promoter AP1 transcription factor binding site is required for expression of involucrin in the corneal epithelium in vivo. Invest Ophthalmol Vis Sci. 2005;46:1219–1227.[Abstract/Free Full Text]
- Adhikary G, Crish JF, Gopalakrishnan R, Bone F, Eckert RL. Involucrin expression in the corneal epithelium: an essential role for Sp1 transcription factors. Invest Ophthalmol Vis Sci. 2005;46:3109–3120.[Abstract/Free Full Text]
- Chiambaretta F, Blanchon L, Rabier B, et al. Regulation of corneal keratin-12 gene expression by the human Krüppel-like transcription factor 6. Invest Ophthalmol Vis Sci. 2002;43:3422–3429.[Abstract/Free Full Text]
- Chiambaretta F, Nakamura H, De Graeve F, et al. Krüppel-like factor 6 (KLF6) affects the promoter activity of the alpha1-proteinase inhibitor gene. Invest Ophthalmol Vis Sci. 2006;47:582–590.[Abstract/Free Full Text]
- Davis J, Duncan MK, Robison WG, Jr, Piatigorsky J. Requirement for Pax6 in corneal morphogenesis: a role in adhesion. J Cell Sci. 2003;116:2157–2167.[Abstract/Free Full Text]
- Hough RB, Piatigorsky J. Preferential transcription of rabbit Aldh1a1 in the cornea: implication of hypoxia-related pathways. Mol Cell Biol. 2004;24:1324–1340.[Abstract/Free Full Text]
- Dwivedi DJ, Pontoriero GF, Ashery-Padan R, Sullivan S, Williams T, West-Mays JA. Targeted deletion of AP-2alpha leads to disruption in corneal epithelial cell integrity and defects in the corneal stroma. Invest Ophthalmol Vis Sci. 2005;46:3623–3630.[Abstract/Free Full Text]
- Francesconi CM, Hutcheon AE, Chung EH, Dalbone AC, Joyce NC, Zieske JD. Expression patterns of retinoblastoma and E2F family proteins during corneal development. Invest Ophthalmol Vis Sci. 2000;41:1054–1062.[Abstract/Free Full Text]
- Lambiase A, Merlo D, Mollinari C, et al. Molecular basis for keratoconus: lack of TrkA expression and its transcriptional repression by Sp3. Proc Natl Acad Sci U S A. 2005;102:16795–16800.[Abstract/Free Full Text]
- Nakamura H, Chiambaretta F, Sugar J, Sapin V, Yue BY. Developmentally regulated expression of KLF6 in the mouse cornea and lens. Invest Ophthalmol Vis Sci. 2004;45:4327–4332.[Abstract/Free Full Text]
- Nakamura H, Ueda J, Sugar J, Yue BY. Developmentally regulated expression of Sp1 in the mouse cornea. Invest Ophthalmol Vis Sci. 2005;46:4092–4096.[Abstract/Free Full Text]
- Saika S, Muragaki Y, Okada Y, et al. Sonic hedgehog expression and role in healing corneal epithelium. Invest Ophthalmol Vis Sci. 2004;45:2577–2585.[Abstract/Free Full Text]
- Sivak JM, Mohan R, Rinehart WB, Xu PX, Maas RL, Fini ME. Pax-6 expression and activity are induced in the reepithelializing cornea and control activity of the transcriptional promoter for matrix metalloproteinase gelatinase B. Dev Biol. 2000;222:41–54.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Sivak JM, West-Mays JA, Yee A, Williams T, Fini ME. Transcription factors Pax6 and AP-2alpha interact to coordinate corneal epithelial repair by controlling expression of matrix metalloproteinase gelatinase B. Mol Cell Biol. 2004;24:245–257.[Abstract/Free Full Text]
- Ueta M, Hamuro J, Yamamoto M, Kaseda K, Akira S, Kinoshita S. Spontaneous ocular surface inflammation and goblet cell disappearance in I kappa B zeta gene-disrupted mice. Invest Ophthalmol Vis Sci. 2005;46:579–588.[Abstract/Free Full Text]
- Chiambaretta F, De Graeve F, Turet G, et al. Cell and tissue specific expression of human Krüppel-like transcription factors in human ocular surface. Mol Vis. 2004;10:901–909.[Web of Science][Medline][Order article via Infotrieve]
- Norman B, Davis J, Piatigorsky J. Postnatal gene expression in the normal mouse cornea by SAGE. Invest Ophthalmol Vis Sci. 2004;45:429–440.[Abstract/Free Full Text]
- Bieker JJ. Krüppel-like factors: three fingers in many pies. J Biol Chem. 2001;276:34355–34358.[Free Full Text]
- Dang DT, Pevsner J, Yang VW. The biology of the mammalian Krüppel-like family of transcription factors. Int J Biochem Cell Biol. 2000;32:1103–1121.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Ehlermann J, Pfisterer P, Schorle H. Dynamic expression of Krüppel-like factor 4 (Klf4), a target of transcription factor AP-2alpha during murine mid-embryogenesis. Anat Rec A Discov Mol Cell Evol Biol. 2003;273:677–680.[CrossRef][Medline][Order article via Infotrieve]
- Garrett-Sinha LA, Eberspaecher H, Seldin MF, de Crombrugghe B. A gene for a novel zinc-finger protein expressed in differentiated epithelial cells and transiently in certain mesenchymal cells. J Biol Chem. 1996;271:31384–31390.[Abstract/Free Full Text]
- Shields JM, Christy RJ, Yang VW. Identification and characterization of a gene encoding a gut-enriched Krüppel-like factor expressed during growth arrest. J Biol Chem. 1996;271:20009–20017.[Abstract/Free Full Text]
- Segre JA, Bauer C, Fuchs E. Klf4 is a transcription factor required for establishing the barrier function of the skin. Nat Genet. 1999;22:356–360.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Katz JP, Perreault N, Goldstein BG, et al. The zinc-finger transcription factor Klf4 is required for terminal differentiation of goblet cells in the colon. Development. 2002;129:2619–2628.[Abstract/Free Full Text]
- Ashery-Padan R, Marquardt T, Zhou X, Gruss P. Pax6 activity in the lens primordium is required for lens formation and for correct placement of a single retina in the eye. Genes Dev. 2000;14:2701–2711.[Abstract/Free Full Text]
- Swamynathan SK, Katz JP, Kaestner KH, Ashery-Padan R, Crawford MA, Piatigorsky J. Conditional deletion of the mouse Klf4 gene results in corneal epithelial fragility, stromal edema, and loss of conjunctival goblet cells. Mol Cell Biol. 2007;27:182–194.[Abstract/Free Full Text]
- Wang Y, Liu T, Gong H, Zhou Q, Sun S, Xie L. Gene profiling in murine corneas challenged with Aspergillus fumigatus. Mol Vis. 2007;13:1226–1233.[Web of Science][Medline][Order article via Infotrieve]
- Huang X, Hazlett LD. Analysis of Pseudomonas aeruginosa corneal infection using an oligonucleotide microarray. Invest Ophthalmol Vis Sci. 2003;44:3409–3416.[Abstract/Free Full Text]
- Saghizadeh M, Kramerov AA, Tajbakhsh J, et al. Proteinase and growth factor alterations revealed by gene microarray analysis of human diabetic corneas. Invest Ophthalmol Vis Sci. 2005;46:3604–3615.[Abstract/Free Full Text]
- Cao Z, Wu HK, Bruce A, Wollenberg K, Panjwani N. Detection of differentially expressed genes in healing mouse corneas, using cDNA microarrays. Invest Ophthalmol Vis Sci. 2002;43:2897–2904.[Abstract/Free Full Text]
- Varela JC, Goldstein MH, Baker HV, Schultz GS. Microarray analysis of gene expression patterns during healing of rat corneas after excimer laser photorefractive keratectomy. Invest Ophthalmol Vis Sci. 2002;43:1772–1782.[Abstract/Free Full Text]
- Davis J, Davis D, Norman B, Piatigorsky J. Gene expression of the mouse corneal crystallin Aldh3a1: activation by Pax6, Oct1, and p300. Invest Ophthalmol Vis Sci. 2008;49:1814–1826.[Abstract/Free Full Text]
- Araki-Sasaki K, Ohashi Y, Sasabe T, et al. An SV40-immortalized human corneal epithelial cell line and its characterization. Invest Ophthalmol Vis Sci. 1995;36:614–621.[Abstract/Free Full Text]
- Kottke MD, Delva E, Kowalczyk AP. The desmosome: cell science lessons from human diseases. J Cell Sci. 2006;119:797–806.[Abstract/Free Full Text]
- Fischbarg J. On the mechanism of fluid transport across corneal endothelium and epithelia in general. J Exp Zool. 2003;300:30–40.
- Verkman AS. Role of aquaporin water channels in eye function. Exp Eye Res. 2003;76:137–143.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Kenney MC, Atilano SR, Zorapapel N, Holguin B, Gaster RN, Ljubimov AV. Altered expression of aquaporins in bullous keratopathy and Fuchs dystrophy corneas. J Histochem Cytochem. 2004;52:1341–1350.[Abstract/Free Full Text]
- Levin MH, Verkman AS. Aquaporin-dependent water permeation at the mouse ocular surface: in vivo microfluorimetric measurements in cornea and conjunctiva. Invest Ophthalmol Vis Sci. 2004;45:4423–4432.[Abstract/Free Full Text]
- Piatigorsky J. Gene sharing in lens and cornea: facts and implications. Prog Retin Eye Res. 1998;17:145–174.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Nees DW, Wawrousek EF, Robison WG, Jr, Piatigorsky J. Structurally normal corneas in aldehyde dehydrogenase 3a1-deficient mice. Mol Cell Biol. 2002;22:849–855.[Abstract/Free Full Text]
- Xu ZP, Wawrousek EF, Piatigorsky J. Transketolase haploinsufficiency reduces adipose tissue and female fertility in mice. Mol Cell Biol. 2002;22:6142–6147.[Abstract/Free Full Text]
- Hu P, Meyers S, Liang FX, et al. Role of membrane proteins in permeability barrier function: uroplakin ablation elevates urothelial permeability. Am J Physiol Renal Physiol. 2002;283:F1200–F1207.[Abstract/Free Full Text]
- Oien KA, McGregor F, Butler S, et al. Gastrokine 1 is abundantly and specifically expressed in superficial gastric epithelium, down-regulated in gastric carcinoma, and shows high evolutionary conservation. J Pathol. 2004;203:789–797.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Kozmik Z. Pax genes in eye development and evolution. Curr Opin Genet Dev. 2005;15:430–438.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Cai S, Lee CC, Kohwi-Shigematsu T. SATB1 packages densely looped, transcriptionally active chromatin for coordinated expression of cytokine genes. Nat Genet. 2006;38:1278–1288.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Kumar PP, Bischof O, Purbey PK, et al. Functional interaction between PML and SATB1 regulates chromatin-loop architecture and transcription of the MHC class I locus. Nat Cell Biol. 2007;9:45–56.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Pavan Kumar P, Purbey PK, Sinha CK, et al. Phosphorylation of SATB1, a global gene regulator, acts as a molecular switch regulating its transcriptional activity in vivo. Mol Cell. 2006;22:231–243.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Russell RG, Lasorella A, Dettin LE, Iavarone A. Id2 drives differentiation and suppresses tumor formation in the intestinal epithelium. Cancer Res. 2004;64:7220–7225.[Abstract/Free Full Text]
- Nebert DW, Roe AL, Dieter MZ, Solis WA, Yang Y, Dalton TP. Role of the aromatic hydrocarbon receptor and [Ah] gene battery in the oxidative stress response, cell cycle control, and apoptosis. Biochem Pharmacol. 2000;59:65–85.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Stefanovic L, Stefanovic B. Mechanism of direct hepatotoxic effect of KC chemokine: sequential activation of gene expression and progression from inflammation to necrosis. J Interferon Cytokine Res. 2006;26:760–770.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Piva R, Belardo G, Santoro MG. NF-kappaB: a stress-regulated switch for cell survival. Antioxid Redox Signal. 2006;8:478–486.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Hai T, Wolfgang CD, Marsee DK, Allen AE, Sivaprasad U. ATF3 and stress responses. Gene Expr. 1999;7:321–335.[Web of Science][Medline][Order article via Infotrieve]
- Chen X, Whitney EM, Gao SY, Yang VW. Transcriptional profiling of Krüppel-like factor 4 reveals a function in cell cycle regulation and epithelial differentiation. J Mol Biol. 2003;326:665–677.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Whitney EM, Ghaleb AM, Chen X, Yang VW. Transcriptional profiling of the cell cycle checkpoint gene krüppel-like factor 4 reveals a global inhibitory function in macromolecular biosynthesis. Gene Expr. 2006;13:85–96.[Web of Science][Medline][Order article via Infotrieve]
- Patel S, Xi ZF, Seo EY, McGaughey D, Segre JA. Klf4 and corticosteroids activate an overlapping set of transcriptional targets to accelerate in utero epidermal barrier acquisition. Proc Natl Acad Sci U S A. 2006;103:18668–18673.[Abstract/Free Full Text]
- Rowland BD, Bernards R, Peeper DS. The KLF4 tumour suppressor is a transcriptional repressor of p53 that acts as a context-dependent oncogene. Nat Cell Biol. 2005;7:1074–1082.[Web of Science][Medline][Order article via Infotrieve]
- Rowland BD, Peeper DS. KLF4, p21 and context-dependent opposing forces in cancer. Nat Rev. 2006;6:11–23.
- Gu LH, Coulombe PA. Keratin function in skin epithelia: a broadening palette with surprising shades. Curr Opin Cell Biol. 2007;19:13–23.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Ramaesh T, Ramaesh K, Martin Collinson J, Chanas SA, Dhillon B, West JD. Developmental and cellular factors underlying corneal epithelial dysgenesis in the Pax6+/– mouse model of aniridia. Exp Eye Res. 2005;81:224–235.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Favre B, Plantard L, Aeschbach L, et al. SLURP1 is a late marker of epidermal differentiation and is absent in Mal de Meleda. J Invest Dermatol. 2007;127:301–308.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Mastrangeli R, Donini S, Kelton CA, et al. ARS Component B: structural characterization, tissue expression and regulation of the gene and protein (SLURP-1) associated with Mal de Meleda. Eur J Dermatol. 2003;13:560–570.[Web of Science][Medline][Order article via Infotrieve]
- Moriwaki Y, Yoshikawa K, Fukuda H, Fujii YX, Misawa H, Kawashima K. Immune system expression of SLURP-1 and SLURP-2, two endogenous nicotinic acetylcholine receptor ligands. Life Sci. 2007;80:2365–2368.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Miwa JM, Stevens TR, King SL, et al. The prototoxin lynx1 acts on nicotinic acetylcholine receptors to balance neuronal activity and survival in vivo. Neuron. 2006;51:587–600.[Medline][Order article via Infotrieve]
- Patel S, Kartasova T, Segre JA. Mouse Sprr locus: a tandem array of coordinately regulated genes. Mamm Genome. 2003;14:140–148.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Tong L, Corrales RM, Chen Z, et al. Expression and regulation of cornified envelope proteins in human corneal epithelium. Invest Ophthalmol Vis Sci. 2006;47:1938–1946.[Abstract/Free Full Text]
- Farkas RH, Chowers I, Hackam AS, et al. Increased expression of iron-regulating genes in monkey and human glaucoma. Invest Ophthalmol Vis Sci. 2004;45:1410–1417.[Abstract/Free Full Text]
- Stasi K, Nagel D, Yang X, Ren L, Mittag T, Danias J. Ceruloplasmin upregulation in retina of murine and human glaucomatous eyes. Invest Ophthalmol Vis Sci. 2007;48:727–732.[Abstract/Free Full Text]
- Gronert K, Maheshwari N, Khan N, et al. A role for the mouse 12/15-lipoxygenase pathway in promoting epithelial wound healing and host defense. J Biol Chem. 2005;280:15267–15278.[Abstract/Free Full Text]
- Bonanno JA. Identity and regulation of ion transport mechanisms in the corneal endothelium. Prog Retin Eye Res. 2003;22:69–94.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Liao SY, Ivanov S, Ivanova A, et al. Expression of cell surface transmembrane carbonic anhydrase genes CA9 and CA12 in the human eye: overexpression of CA12 (CAXII) in glaucoma. J Med Genet. 2003;40:257–261.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
R. D. Young, S. K. Swamynathan, C. Boote, M. Mann, A. J. Quantock, J. Piatigorsky, J. L. Funderburgh, and K. M. Meek
Stromal Edema in Klf4 Conditional Null Mouse Cornea Is Associated with Altered Collagen Fibril Organization and Reduced Proteoglycans
Invest. Ophthalmol. Vis. Sci.,
September 1, 2009;
50(9):
4155 - 4161.
[Abstract]
[Full Text]
[PDF]
|
 |
|