Originally published In Press as
doi:10.1167/iovs.08-1957 on May 23, 2008
(Investigative Ophthalmology and Visual Science. 2008;49:3812-3820.)
© 2008 by The Association for Research in Vision and Ophthalmology, Inc.
doi:10.1167/iovs.08-1957
Duplication and Divergence of Zebrafish CRALBP Genes Uncovers Novel Role for RPE- and Müller-CRALBP in Cone Vision
Ross Collery,1
Sarah McLoughlin,1
Victor Vendrell,1
Jennifer Finnegan,1
John W. Crabb,2
John C. Saari,3 and
Breandán N. Kennedy1
1From the UCD Conway Institute and UCD School of Biomolecular and Biomedical Sciences, University College Dublin, Dublin, Ireland; the
2Cole Eye Institute, Cleveland Clinic Foundation, Cleveland, Ohio; and the
3Department of Ophthalmology, University of Washington, Seattle, Washington.
 |
Abstract
|
|---|
PURPOSE. During vertebrate phototransduction 11-cis-retinal is isomerized to all-trans-retinal. Light sensitivity is restored by recombination of apo-opsin with 11-cis-retinal to regenerate visual pigments. The conversion of all-trans retinal back to 11-cis-retinal is known as the visual cycle. Within the retina, cellular retinal-binding protein (CRALBP) is abundantly expressed in the retinal pigment epithelium (RPE) and Müller glia. CRALBP expressed in the RPE is known to facilitate the rate of the rod visual cycle. Recent evidence suggests a role for Müller glia in an alternate cone visual cycle. In this study, the role of RPE- and Müller-CRALBP in cone vision was characterized.
METHODS. The CRALBP orthologues rlbp1a and rlbp1b were identified in zebrafish by bioinformatic methods. The spatial and developmental expression of rlbp1a and rlbp1b was determined by in situ hybridization and immunohistochemistry. Depletion of the expression of the corresponding Cralbp a and Cralbp b proteins was achieved by microinjection of antisense morpholinos. Visual function was analyzed in 5-day post fertilization (dpf) larvae using the optokinetic response assay.
RESULTS. The zebrafish genome contains two CRALBP ohnologues, rlbp1a and rlbp1b. These genes have functionally diverged, exhibiting differential expression at 5 dpf in RPE and Müller glia, respectively. Depletion of CRALBP in the RPE or Müller glia results in abnormal cone visual behavior.
CONCLUSIONS. The results suggest that cone photoreceptors incorporate 11-cis-retinoids derived from the rod and cone visual cycles into their visual pigments and that Müller-CRALBP participates in the cone visual cycle.
The visual system transforms light impulses detected by photoreceptors in the retina into images of the external environment. Rod photoreceptors function during dim nightlight conditions, whereas vision in daylight is mediated by cone photoreceptors. Cones can adapt to
10 log units of illumination, and subtypes of cones have distinct spectral sensitivities enabling daylight color vision.1 2
In vertebrate photoreceptors, light is sensed by photopigments that consist of an opsin G-protein-coupled receptor and the light-sensitive chromophore 11-cis-retinal (for review, see Ref. 3 ). Different opsin proteins are present in each rod and cone, resulting in different spectral sensitivities. In rods, light photoisomerizes 11-cis-retinal in the photopigment to all-trans-retinal. This process induces a conformational change in rhodopsin, activating the phototransduction cascade. This cascade sends signals via the optic nerve to the visual cortex of the brain, where impulses are interpreted as a visual image. The process of regeneration of the rod photopigment is known as the rod visual cycle and requires regeneration of 11-cis-retinal from all-trans-retinal (for reviews see Refs. 4 5 ). The process involves chemical modification and shuttling of retinoid intermediates within rods and the surrounding retinal pigment epithelium.
Cellular retinaldehyde-binding protein (CRALBP) is a cytoplasmic protein, abundantly expressed in the retinal pigment epithelium (RPE) and Müller glia of the retina and in the pineal gland.6 7 8 Structurally, human CRALBP is a
36-kDa monomeric protein, proposed to adopt an "open" or "closed" conformation, depending on whether it is carrying an endogenous ligand.9 CRALBP interacts structurally and functionally with 11-cis-retinol dehydrogenase (RDH5), an enzyme of the visual cycle in RPE.10 CRALBP is a member of the CRAL_TRIO family of proteins that share a lipid-binding domain derived from the yeast Sec14 protein.11 Residues 120-313 comprise the ligand-binding pocket within which retinoid-interacting residues, including W165, Y179, F197, C198, M208, Q210, M222, V223, M225, and W244, have been identified.9 12 13 14 15 The C terminus of CRALBP binds to the PDZ-domains of ezrin-radixin-moesin (ERM)–binding phosphoprotein50/sodium hydrogen exchanger regulatory factor-1 (EBP50/NHERF-1), which in turn binds to ezrin and actin, proteins localized to the apical processes of the retinal pigment epithelium and Müller glial cells.16 17 The (N/D)TA(L/F) minimum binding motif at the CRALBP C terminus is found in multiple CRALBP orthologues and is proposed to bind CRALBP to apical processes of RPE cells and apical microvilli of Müller cells.
CRALBP contains a high-affinity binding site for 11-cis-retinal or 11-cis-retinol, vitamin A metabolites uniquely associated with sensing light.18 RPE-CRALBP facilitates 11-cis-retinal regeneration during the rod visual cycle. The functional requirement of CRALBP in retinal Müller cells and in the pineal gland is unknown. Mutations in the single human CRALBP gene, RLBP1, can lead to forms of blindness that reflect retinitis punctata albescens, a photoreceptor degeneration accompanied by subretinal, white-to-yellow punctate deposits and delayed rod and cone resensitization.19 20 21 22 These mutations can tighten or abolish CRALBP ligand binding.10 21 Rlbp1–/– (knockout) mice have delayed rhodopsin regeneration and dark adaptation after illumination coupled with diminished 11-cis-retinal production.23 However, photoreceptor degeneration characteristic of missense mutations in human CRALBP are not recapitulated in the Rlbp1–/– mouse.
RPE-CRALBP is an established facilitator of 11-cis-retinal regeneration during the rod visual cycle, accelerating the isomerization of all-trans- to 11-cis-retinol.23 24 25 Recently, evidence of a novel pathway that regenerates cone photopigments, the cone visual cycle, has accumulated.26 27 28 29 30 This cycle appears to involve a novel biochemical pathway for regenerating 11-cis-retinal involving enzymatic modification and shuttling of intermediates within cones and surrounding Müller glial cells.28 The expression of CRALBP in Müller cells and the binding of CRALBP to 11-cis-retinoids suggest that Müller- CRALBP plays a key role in the cone visual cycle.
The function of Müller-CRALBP has not been selectively assessed. Although patients with missense CRALBP mutations and CRALBP knockout mice display abnormal cone responses, the phenotype could arise from defective RPE- and/or Müller-CRALBP, as there is a single mammalian gene.19 23 Approaches to dissecting the role(s) of retinal CRALBP include generating models with selective loss of RPE- or Müller-CRALBP. This loss can be achieved in mice by using conditional knockout approaches, but is time-consuming and expensive and requires the maintenance of several transgenic lines. An alternative is the zebrafish, which has abundant cones and is amenable to genetic manipulation.
In the current study, we demonstrated that zebrafish contain two CRALBP ohnologues and that these duplicated genes have diverged such that zebrafish rlbp1a/Cralbp a is predominantly expressed in the RPE and zebrafish rlbp1b/Cralbp b is predominantly expressed in Müller glia. Using antisense morpholino technology for selective knockdown of RPE-CRALBP or Müller-CRALBP, we demonstrated that depletion of either pool results in abnormal cone-mediated vision. This finding suggests that RPE- and Müller-CRALBP function in the cone visual cycle.
 |
Materials and Methods
|
|---|
Animal Breeding and Maintenance
Zebrafish were treated in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. They were maintained and raised under standard conditions at 28.5°C on a 14-hour light:10-hour dark cycle. Wild-type Tübingen zebrafish embryos were obtained by natural spawning and raised in embryo medium.31 Larvae used for in situ hybridization were raised in embryo medium supplemented with 0.003% phenylthiourea (Sigma-Aldrich) to inhibit pigmentation. Larvae were staged according to their age in days post fertilization (dpf).
Sequence Analysis
Human CRALBP protein sequence (P12271) was used as a probe to search Ensembl, build version 7 (http://www.ensembl.org/32 ) for orthologous sequences in multiple species using the BLAST algorithm. Two zebrafish ohnologues, rlbp1a and rlbp1b (NP_991253; NP_956999), were identified, along with orthologues from chimpanzee (Pan troglodytes, XP_510580), cow (Bos taurus, NP_776876), mouse (Mus musculus, NP_065624), rat (Rattus norvegicus, NP_001099744), chicken (Gallus gallus, NP_001019865), tropical frog (Xenopus tropicalis, NP_001005455), African clawed toad (Xenopus laevis, AAH54209), pufferfish (two ohnologues; Fugu rubripes; SINFRUP00000129793, SINFRUP00000164753), and cavefish (two ohnologues; Tetraodon nigriviridis; CAG01050, CAF99866). Protein alignments and phylogenetic tree-building were performed in CLUSTAL W (http://www.ebi.ac.uk/Tools/clustalw2/index.html/ provided in the public domain by European Bioinformatics Institute, European Molecular Biology Laboratory, Heidelberg, Germany) with default settings. The results were annotated in image-analysis software (Illustrator, ver. 11; Adobe Systems, San Jose, CA).
Wholemount In Situ Hybridization
PCR primers amplified full-length cDNAs of rlbp1a and rlbp1b and introduced 5' clamps and restriction sites to facilitate cloning (in italic) (rlbp1a-F1, cgcggatcc CTCTCACAGAACGTTGCATTG; rlbp1a-R1, cgcgaattc GACAAAGAACAGGAATGCCTGG; and rlbp1b-F1, cgcggatcc TGGAGAATCTGAGCACTATGGC; rlbp1b-R1, cgcgaattc CTGGAAAACCAATATGGGTTAAAACGACG). Total RNA was extracted from adult zebrafish eyes (TRIzol; Invitrogen, Carlsbad, CA), genomic DNA was digested (RQ1 DNase; Promega, Madison, WI), and cDNA was synthesized with an RT-PCR system (Thermoscript; Invitrogen), with random hexamers used to initiate synthesis. rlbp1a and rlbp1b cDNAs were cloned into the expression vector pCS2P+ and used as templates for synthesis of antisense and sense digoxigenin-labeled riboprobes. Larval zebrafish were fixed in 4% formaldehyde/PBS. In situ hybridization was performed essentially as previously described.33 Larvae were photographed under 100% glycerol (StereoLumar V12 microscope; Carl Zeiss Meditec, Inc., Dublin, CA). Photographs were oriented on computer (Photoshop ver. 5 software; Adobe Systems).
Western Blot Analysis and Immunohistochemistry
Adult zebrafish were dark-adapted before dissection of whole eyes, RPE, and neuroretina. Tissues were homogenized and boiled in 1x SDS-PAGE electrophoresis buffer (16 mM Tris [pH 6.8]), 8% glycerol, 0.6% SDS, 270 mM β-mercaptoethanol, and 0.003% bromophenol blue). Samples were separated on a 15% SDS-polyacrylamide gel for 2 hours before overnight transfer to a nitrocellulose membrane. CRALBP isoforms were immunodetected by using a polyclonal antibody to bovine CRALBP (UW55; kind gift of one of the authors; JCS) followed by HRP-conjugated goat anti-rabbit IgG (Sigma-Aldrich) and chemiluminescence reagents (ECL; GE Healthcare, Piscataway, NJ).
Adult and larval zebrafish eyes were fixed with 4% formaldehyde and cryoprotected by a sucrose series before embedding in OCT (Sakura Fintek, Torrance, CA). Twelve-micrometer sections were cut and thaw-mounted onto charged slides (Superfrost Plus; Fisher Scientific, Pittsburgh, PA). The sections were rehydrated, blocked in 2% (vol/vol) normal goat serum, 1% bovine serum albumin, and 1% Triton X-100 in PBS before incubating overnight at 4°C with polyclonal anti-CRALBP antibody. Polyclonal blue opsin (kind gift of David Hyde, Department of Biological Sciences, University of Notre Dame, Notre Dame, IN) and monoclonal zpr-134 antibodies probed for cone-specific markers. Slides were rinsed in PBS before incubating with Cy2 or Cy3-conjugated goat anti-rabbit/mouse secondary antibody as appropriate (Jackson ImmunoResearch Europe Ltd., Newmarket, UK). After rinsing in PBS and counterstaining with 300 nM DAPI, slides were mounted (Vectashield; Vector Laboratories, Burlingame, CA). Sections were examined with a laser scanning confocal microscope (LSM 510 Meta; Carl Zeiss Meditec, Inc.). Images were taken using with an oil-immersion lens (Plan-Apochromat 63x/1.4 Oil DIC objective lens; Carl Zeiss Meditec, Inc.) with a 12-bit pixel depth and a resolution of 512 x 512 pixels.
Morpholino Knockdown
Morpholino oligonucleotides targeting ATG translational start sites of rlbp1a and rlbp1b were designed by Gene Tools (Gene Tools LLC, Philomath, OR) from cDNA sequences (rlbp1a start blocking MO, TTCCACTAACAACCGCCATTGCTTC; rlbp1b start blocking MO, CGAAAACTTCCAGTAGCAGCCATAG). Morpholino oligonucleotides were resuspended in nuclease-free water and injected into wild-type, one- to two-cell zebrafish embryos along with 0.01% phenol red tracer dye.
Optokinetic Response Assay
The optokinetic response assay was performed essentially as previously described.35 This assay uses eye movement to calculate visual response to a moving stimulus. Briefly, 5 dpf larval zebrafish were placed in a Petri dish containing 9% methylcellulose to immobilize the larvae, while allowing respiration to continue. A drum containing alternating black-and-white stripes (18° per stripe) was rotated at a speed of 20 rpm. Larvae were recorded during 5 seconds of no rotation, 25 seconds of clockwise rotation, 5 seconds of no rotation, and 25 seconds of anticlockwise rotation. The number of saccades per minute was quantified with a microscope equipped with a digital camera (model SZX16 microscope with a model DP71 digital camera and Cell F software; Olympus, Tokyo, Japan).
RT-PCR of the 5'-UTR
Total RNA was extracted from adult zebrafish eyes (TRIzol; Invitrogen) and resuspended in nuclease-free water. The concentration and purity of RNA were measured with a spectrophotometer (NanoDrop Technologies, Wilmington, DE), and contaminating genomic DNA was removed using RQ1 DNase (Promega). RNA was stored at –80°C until used. Reverse transcription was performed on 1 µg total RNA with an RT-PCR system (Thermoscript; Invitrogen) at 50°C, after priming with random hexamers. Synthesized cDNA was stored at –20°C until used. cDNA was used in standard PCR reactions with 1 µL cDNA per 25 µL PCR reaction, in standard PCR conditions, with extension times adjusted to 1 minute per kilobase of target amplicon. Primers were designed complementary to expressed sequence tags (ESTs) identified after BLAST analysis of EST databases with full-length rlbp1a mRNA sequence as the probe (EST: AGENCOURT_21412034, GenBank Acc: CN177714) (rlbp1a –ex(–4)-F1, GAGCTCTGTCATTCTGCGGGTC; rlbp1a ex(–3)-F1, GGCATGTTCCCAGAGCTCTGTCA; rlbp1a –ex(–2)-F1, GGAAACACCTCAACAGCAATG; rlbp1a –ex(–1)-F1, GAGGTCGCAGTACAAATGAGTGG; rlbp1a –ex(+1)-R1, GCTTCAAATACTCAATGCAACG).
 |
Results
|
|---|
Two Cralbp Ohnologues in Zebrafish
Using the human CRALBP protein sequence as a probe, we identified two CRALBP ohnologues in the zebrafish genome. The teleost genome has duplicated since its radiation from other vertebrates, accounting for the presence of two CRALBP genes in zebrafish (Danio rerio), cavefish (Tetraodon nigriviridis), and pufferfish (Fugu rubripes)36 (Fig. 1A) . rlbp1a and rlbp1b are located on zebrafish chromosomes 25 and 7, respectively (Fig. 1B) . The encoded proteins, zebrafish Cralbp a and Cralbp b, have
64% and
56% protein identity, respectively, to human CRALBP,
81% protein identity to each other, and predicted sizes of
35.5 and 35.7 kDa, respectively (Fig. 1C) . Of the 10 residues specifically implicated in the ligand-binding pocket of human CRALBP, 8 are evolutionarily conserved in zebrafish. In addition, residues R150 and R233, associated with inherited forms of blindness, are conserved across all orthologues.19 20 21 Whereas Cralbp b contains the C-terminal DTAL sequence associated with binding to the PDZ-domains of EBP50/NHERF-1,16 37 Cralbp a does not, suggesting altered function or subcellular localization (Supplementary Fig. S1, online at http://www.iovs.org/cgi/content/full/49/9/3812/DC1). We note that human proteins named CRALBP-like 138 and CRALBP-like 2 (NP_001010852) have been reported; however, as these proteins have only
41% and
43% protein identity to human CRALBP, respectively, they were not considered true CRALBP orthologues.

View larger version (28K):
[in this window]
[in a new window]
|
FIGURE 1. Zebrafish CRALBP orthologues. (A) A phylogenetic alignment of CRALBP protein orthologues was built (DS Gene ver. 1.5; Accelrys, Inc., San Diego, CA). The branch length is proportional to the amount of inferred evolutionary change. Duplication of the fish genome resulted in two zebrafish and tetraodon CRALBP ohnologues. (B) The exon–intron structures of rlbp1a (Bi) and rlbp1b (Bii) are shown in a genomic context. Exons are numbered 1 to 7 based on current Ensembl notation, and extra rlbp1a exons discovered during this study are numbered –3 to –1. Blue: coding regions. (C) Alignment of human, mouse, and zebrafish CRALBP protein sequences. Numbers represent amino acid positions. Red: missense mutations associated with inherited blindness. Blue horizontal bar: ligand-binding pocket of human CRALBP; green: residues involved in ligand binding. Bold red: residue M225, also a disease mutation. PDZ-domain target motifs at the C termini of orthologues are boxed.
|
|
Exon–Intron Structure of the Zebrafish CRALBP Genes
The coding regions of rlbp1a and rlbp1b comprise seven exons and six introns (Fig. 1 and Supplementary Figs. S2, S3). The size of the coding exons is highly conserved, although the intron sizes have changed considerably (Table 1) . Searches of ESTs reveal three putative noncoding exons (exon –3, –2, and –1) in the 5'UTR of rlbp1a but not of rlbp1b. Alignments with genomic sequence demonstrate these exons to extend
12 kb upstream of the rlbp1a translational start site with introns of 1375, 9116, and 1301 nt, respectively (Supplementary Fig. S4). In agreement with the bioinformatic analyses, PCR using primers extending from these noncoding exons to exon 1 demonstrate they are incorporated into transcripts in adult eye mRNA. It is unclear whether these noncoding exons represent alternative promoter start sites or alternative splice forms.
Expression of rlbp1a and rlbp1b in Larval Pineal and Eye
The spatial and temporal expression of rlbp1a/Cralbp a and rlbp1b/Cralbp b transcripts was determined by wholemount in situ hybridization. Both rlbp1a and rlbp1b were expressed in the developing eye and pineal gland from 1 dpf and were strongly expressed in those organs from 3 to 5 dpf (Figs. 2 3) . At 7 dpf, rlbp1a was expressed in the eye, but was not detected in the pineal gland, whereas rlbp1b was expressed in both the eye and pineal. Approximately 50% of larvae examined showed parapineal expression of rlbp1b. The parapineal gland is located ventrolateral to the pineal and is thought to regulate asymmetric brain development.39 To determine whether expression of either zebrafish CRALBP gene exhibited circadian or diurnal regulation, we performed wholemount in situ hybridization on embryos collected during mid-light and mid-dark time points (Fig. 2) . No obvious change in the pineal expression level of rlbp1a or rlbp1b was observed during light and dark phases. Larvae probed for aanat2 showed the expected cyclic dark-phase upregulation and light-phase downregulation.40 Thus, neither Cralbp a nor Cralbp b displayed evidence of circadian or diurnal expression profiles in the pineal.

View larger version (98K):
[in this window]
[in a new window]
|
FIGURE 2. Expression of rlbp1a and rlbp1b in the pineal during larval development. In situ hybridization shows rlbp1a and rlbp1b expression in the pineal at 1 dpf (A, E) and increasing at 3 to 5 dpf (B, C, F, G). Expression of rlbp1b remains strong in the pineal at 7 dpf (H). (F, Inset) The pineal with the parapineal showed expression to the left (blue bracket). Rlbp1a and rlbp1b did not show diurnal or circadian expression (I–N). Dorsal images of 3 dpf larvae harvested in light (I, J, K) and dark (L, M, N) phases and probed for rlbp1a and rlbp1b and aanat2 transcripts. Arrows: the pineal.
|
|

View larger version (43K):
[in this window]
[in a new window]
|
FIGURE 3. Differential expression of CRALBP isoforms in adult zebrafish retina. (A) Immunohistochemistry with a pan-anti-CRALBP antibody labeled adult RPE and Müller glia. (B–D) Müller-CRALBP colocalized with GFP expressed under control of a Müller-specific GFAP promoter. (E) Western blot showing two CRALBP isoforms present in the whole zebrafish eye, one exclusively expressed in the neural retina, and the other in the RPE. Bovine and mouse eye samples showed the expected single band of CRALBP.
|
|
Expression of Zebrafish CRALBP Isoforms in Müller Glia and RPE
Analysis of CRALBP protein expression in zebrafish was performed with a polyclonal antibody raised against recombinant bovine CRALBP8 that does not distinguish between zebrafish Cralbp a and Cralbp b isoforms (Fig. 3) . Consistent with other species, immunohistochemical staining of retinal sections confirmed extensive expression of zebrafish Cralbp a/Cralbp b in the RPE and Müller glia (Fig. 3A) . Expression was strongest toward the ganglion cell layer where the Müller end feet are located (Fig. 3A) . Müller glial expression was verified by colocalization with GFP expressed under the control of a promoter for glial fibrillary acidic protein (GFAP), an established Müller marker (Fig. 3B) .41 Western blot analyses provided the first indication that the RPE and Müller glia express unique CRALBP isoforms. The analysis revealed distinct bands of
33 to 35 kDa in protein extracted from the entire retina. The slower mobility isoform was specific to the RPE, and the faster mobility isoform specific to the neuroretina (Fig. 3E) .
As duplicated genes often diverge in function, we hypothesized that the zebrafish CRALBP ohnologues evolve distinct expression profiles in the retina. In situ hybridizations with gene-specific probes indicated that at 5 dpf rlbp1a was predominantly expressed in the RPE and rlbp1b in Müller glia (Figs. 4A 4B 4C 4D 4E 4F) . Retinal cryosections demonstrated robust expression of rlbp1b in Müller cells (Fig. 4E) , which had projections spanning the retina and nuclei in the inner nuclear layer.42 rlbp1a and rlbp1b were also expressed at the interface between the retina and the olfactory placodes (Figs. 4B 4E) and rlbp1b was expressed in the ciliary epithelium, as shown in other species.43 44

View larger version (62K):
[in this window]
[in a new window]
|
FIGURE 4. Differential expression of rlbp1a and rlbp1b in RPE and Müller glia. Wholemount in situ hybridization showed rlbp1a and rlbp1b to be expressed in the eye at 5 dpf (A, D), although rlbp1a was predominant in the RPE and rlbp1b in the inner nuclear layer (B, C, E, F). rlbp1a and rlbp1b were expressed at the interface between the retina and the olfactory placodes and rlbp1b in the ciliary epithelium (B, E). Cryosections probed with pan-anti-CRALBP antibody showed extensive staining in the RPE and Müller glial cells in wild-type larvae (G). Morpholino knockdown of Cralbp a depleted CRALBP expression in the RPE (H), whereas knockdown of Cralbp b depleted CRALBP expression in Müller glia (I). Knockdown of Cralbp a (K, N) or Cralbp b (L, O) does not affect cone morphology or cone marker expression (blue opsin [short-single cones] or zpr-1 [double cones]) compared with wild-type (J, M). RPE, retinal pigment epithelium; ONL, outer nuclear layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer; OP, olfactory placode; CMZ, ciliary marginal zone; CE, ciliary epithelium. Scale bars: (A–I) 50 µm; (J–O) 20 µm.
|
|
The results conflicted with the Western blot data as Cralbp b is predicted to have a slower mobility than Cralbp a. Many proteins, including proteins found in the retina, do not segregate at the predicted size on Western blots, which may be due to posttranslational modification. To confirm the in situ findings at the protein level, we microinjected antisense morpholinos, for selective translational block of each zebrafish CRALBP ohnologue, and analyzed Cralbp a/Cralbp b expression in corresponding retinal sections using the pan-CRALBP antibody. Cralbp a knockdown resulted in a specific depletion of CRALBP labeling in the RPE, but not in Müller glia, whereas Cralbp b knockdown resulted in a specific depletion of CRALBP labeling in Müller glia but not in the RPE (Figs. 4G 4H 4I) . No change in gross cone morphology or expression of cone- or rod-specific markers was observed after specific knockdown of either Cralbp a or Cralbp b (Figs. 4J 4K 4L 4M 4N 4O and data not shown). Thus, the zebrafish genome contains duplicated CRALBP genes that, at 5 dpf, exhibit exclusive patterns of expression within the RPE (rlbp1a) or Müller glia (rlbp1b).
Müller- and RPE-CRALBP in Cone Vision
At 5 dpf, zebrafish vision is mediated by cone photoreceptors, and the rod photoreceptors, though present, do not contribute to visual function.45 The ability to deplete RPE-CRALBP or Müller-CRALBP selectively at 5 dpf enabled us to assess their contribution to cone vision by using the optokinetic response assay. In this assay, larval fish are immobilized in a viscous medium that allows free rotation of the eyes, and a drum lined with alternating black and white stripes rotates about the larvae.35 A saccade, or change in eye angle greater than 20°C in response to this moving stimulus is easily observed, and the number of saccades as a function of time is used as a quantitative test for visual response. Wild-type and control morpholino-injected larvae responded with
25 to 30 saccades per minute of drum rotation (Fig. 5) . Knockdown of RPE-CRALBP or Müller-CRALBP resulted in a statistically significant reduction in saccade response, showing that zebrafish CRALBP expressed in RPE and Müller glia are independently essential for normal cone vision.

View larger version (11K):
[in this window]
[in a new window]
|
FIGURE 5. Knockdown of Cralbp a or Cralbp b caused impaired optokinetic response. Optokinetic response was measured in wild-type larvae and larvae injected with control morpholino or cralbp a and cralbp b translation blocking morpholinos at 5 dpf. A Students t-test calculated significance of differences in number of saccades. ***P <0.001 and **P < 0.01; n 10 animals per group; error bars, SD. MO, morpholino.
|
|
 |
Discussion
|
|---|
Although the complete functional profile of CRALBP is unknown, its physiological importance is underlined by genetic association with heritable forms of blindness.19 20 21 CRALBP is a known component of the rod visual cycle regeneration of 11-cis-retinal, where it functions as an acceptor of 11-cis-retinol and a substrate carrier for 11-cis-retinol dehydrogenase (RDH5).12 46 Insights into CRALBP function have been gathered from rod-dominant models.12 16 23 In the present study, using the cone-dominant zebrafish, we identified two CRALBP ohnologues and characterize their expression and function.
Both zebrafish CRALBP genes were expressed in the sensory pineal at early developmental stages, but by 7 dpf, only rlbp1b continued to exhibit pineal expression. CRALBP expression in the pineal was observed earlier than in the retina, consistent with the rapid organogenesis of the zebrafish pineal.40 Many phototransduction components, though expressed in mammalian and nonmammalian pineals, are probably evolutionary relics, as entrainment of circadian output from the mammalian pineal is controlled by light-sensitive ganglion cells in the retina.47 However, in zebrafish, signals from the eye are not necessary for circadian entrainment, and the pineal contains conelike photoreceptors that are directly sensitive to light.48 49 We found no evidence that either zebrafish CRALBP ohnologue is under diurnal or circadian regulation in the pineal. However, it is plausible that pineal CRALBP(s) regulate entrainment of circadian rhythms to new light–dark cycles. Further studies are needed to resolve the potential role for CRALBP in olfaction. Our data indicate expression of zebrafish CRALBP genes in olfactory placodes, consistent with a recent report implicating Pax6 as a regulator of CRALBP expression in the developing mouse brain50 and the established role of Pax6 in eye and olfactory system development.51 52
In the retina, recent work in cone-dominant models has hypothesized a cone visual cycle involving Müller- CRALBP.26 28 29 Characterization of the cone visual cycle is warranted given that loss of cone vision results in debilitating blindness.53 CRALBP knockout mice have abnormal cone physiology, but this effect cannot be attributed solely to either RPE- or Müller-CRALBP, as expression is eliminated in both locations.23 The duplication and divergence of expression of zebrafish CRALBP ohnologues has enabled us to analyze the role of each ohnologue selectively. In our study, rlbp1b was predominantly expressed in Müller glial cells and rlbp1a in the RPE. Knockdown of either RPE-CRALBP or Müller-CRALBP resulted in abnormal cone vision. Based on the known biochemistry of CRALBP, abnormal cone vision resulting from zebrafish Cralbp a/Cralbp b depletion probably resulted from impaired retinoid metabolism, culminating in delayed regeneration of 11-cis-retinal and diminished visual pigment assembly.23 In summary, our data (1) provide primary evidence confirming that Müller-CRALBP contributes to cone vision and (2) demonstrates a novel role for RPE-CRALBP in contributing to cone vision.
We propose a revised model of CRALBP function in the rod and cone visual cycles (Fig. 6) . RPE-CRALBP facilitates provision of the 11-cis-retinal required by rods for visual pigment regeneration as previously described.16 24 Müller-CRALBP, and perhaps RPE-CRALBP, facilitate the provision of 11-cis-retinol to cones. Unlike rods, cones have an 11-cis-retinol dehydrogenase activity that oxidizes 11-cis-retinol to 11-cis-retinal.26 55 Furthermore, cones, but not rods, can regenerate visual pigments from 11-cis-retinol or 11-cis-retinal.55 Thus, we speculate that RPE-CRALBP facilitates the provision of 11-cis-retinal to cones. This suggests two cell sources and three pathways that provide 11-cis-retinoids to cones compared with one for rods. However, CRALBP purified from RPE has been found bound only to 11-cis-retinal, whereas CRALBP purified from the neuroretina is bound to 11-cis-retinal and 11-cis-retinol.54 Thus, further investigation and refinement of the model is warranted, as the model does not pinpoint a location in the neuroretina where CRALBP is bound to 11-cis-retinal.

View larger version (34K):
[in this window]
[in a new window]
|
FIGURE 6. Proposed model of CRALBP function in the rod and the cone visual cycles. RPE-CRALBP and Müller-CRALBP contribute retinol/al to the photoreceptors after retinoid regeneration. Pathways depicted are as follows: (1) 11-cis-retinal is exported to rods from the RPE16 24 ; (2) 11-cis-retinol may be exported to cones from the Müller glia; (3) 11-cis-retinol may be exported to cones from the RPE; (4) 11-cis-retinal may be exported to cones from the RPE. Although 11-cis-retinal bound to CRALBP has been purified from the neuroretina, its exact location is unknown and is not identified in this proposed model. CRALBP is shown bound to 11-cis-retinal and 11-cis-retinol in the RPE, though only 11-cis-retinal bound to CRALBP has been isolated from this tissue.22 54
|
|
A recent report provides evidence of the existence of a previously unannotated, noncoding exon in the human RLBP1 gene.56 The data suggest the presence of alternative transcription start sites in the human CRALBP gene, although it remains to be determined whether in vivo these are uniquely or preferentially used during development or in specific cells. We also identify previously unidentified, noncoding exons in the zebrafish rlbp1a gene and confirm their presence in transcripts containing the rlbp1a coding sequence. Zebrafish represent an excellent model system with which to characterize the regulation of CRALBP genes in vivo because of their amenability to transient transgenesis, rapid development, and transparency. In addition, the duplication and divergence of expression of zebrafish CRALBP genes provides a serendipitous model to distinguish the transcriptional regulators of RPE- and Müller-specific expression.
 |
Acknowledgements
|
|---|
The authors thank Stephan Neuhauss and Helia Schönthaler for helpful discussions, Ann Cullen for assistance with confocal microscopy, and the Conway Institute Biotechnical Services for animal husbandry.
 |
Footnotes
|
|---|
Supported by research project Grant RP/2006/277 from the Irish Health Research Board (BNK). Zpr-1 was provided by the Zebrafish International Resource Center (ZIRC) which is supported by National Institutes of Health-National Center for Research Resources (NIH-NCRR) Grant P40 RR12546.
Submitted for publication March 1, 2008; revised April 18, 2008; accepted July 24, 2008.
Disclosure: R. Collery, None; S. McLoughlin, None; V. Vendrell, None; J. Finnegan, None; J.W. Crabb, None; J.C. Saari, None; B.N. Kennedy, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: Breandán N. Kennedy, UCD Conway Institute, UCD School of Biomolecular and Biomedical Sciences, University College Dublin, Dublin 4, Ireland; brendan.kennedy{at}ucd.ie.
 |
References
|
|---|
- Normann RA, Werblin FS. Control of retinal sensitivity. I. Light and dark adaptation of vertebrate rods and cones. J Gen Physiol. 1974;63(1)37–61.[Abstract/Free Full Text]
- Ebrey T, Koutalos Y. Vertebrate photoreceptors. Prog Retin Eye Res. 2001;20(1)49–94.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Blomhoff R, Blomhoff HK. Overview of retinoid metabolism and function. Neurobiology. 2006;66(7)606–630.[CrossRef]
- Saari JC, Crabb JW. Genetic and proteomic analyses of the mouse visual cycle. Chalupa LM Williams R eds. Eye, Retina, and Visual System of the Mouse. ; The MIT Press Cambridge, MA. In press
- Lamb TD, Pugh EN, Jr. Dark adaptation and the retinoid cycle of vision. Prog Retin Eye Res. 2004;23(3)307–380.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Saari JC, Futterman S, Bredberg L. Cellular retinol- and retinoic acid-binding proteins of bovine retina: purification and properties. J Biol Chem. 1978;253(18)6432–6436.[Free Full Text]
- Futterman S, Saari JC. Occurrence of 11-cis-retinal-binding protein restricted to the retina. Invest Ophthalmol Vis Sci. 1977;16(8)768–771.[Abstract/Free Full Text]
- Bunt-Milam AH, Saari JC. Immunocytochemical localization of two retinoid-binding proteins in vertebrate retina. J Cell Biol. 1983;97(3)703–712.[Abstract/Free Full Text]
- Wu Z, Hasan A, Liu T, Teller DC, Crabb JW. Identification of CRALBP ligand interactions by photoaffinity labeling, hydrogen/deuterium exchange, and structural modeling. J Biol Chem. 2004;279(26)27357–27364.[Abstract/Free Full Text]
- Golovleva I, Bhattacharya S, Wu Z, et al. Disease-causing mutations in the cellular retinaldehyde binding protein tighten and abolish ligand interactions. J Biol Chem. 2003;278(14)12397–12402.[Abstract/Free Full Text]
- Panagabko C, Morley S, Hernandez M, et al. Ligand specificity in the CRAL-TRIO protein family. Biochemistry. 2003;42(21)6467–6474.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Crabb JW, Nie Z, Chen Y, et al. Cellular retinaldehyde-binding protein ligand interactions: Gln-210 and Lys-221 are in the retinoid binding pocket. J Biol Chem. 1998;273(33)20712–20720.[Abstract/Free Full Text]
- Liu T, Jenwitheesuk E, Teller DC, Samudrala R. Structural insights into the cellular retinaldehyde-binding protein (CRALBP). Proteins. 2005;61(2)412–422.[CrossRef][Medline][Order article via Infotrieve]
- Wu Z, Yang Y, Shaw N, et al. Mapping the ligand binding pocket in the cellular retinaldehyde binding protein. J Biol Chem. 2003;278(14)12390–12396.[Abstract/Free Full Text]
- Wu Z, Bhattacharya SK, Jin Z, et al. CRALBP ligand and protein interactions. Adv Exp Med Biol. 2006;572:477–483.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Nawrot M, West K, Huang J, et al. Cellular retinaldehyde-binding protein interacts with ERM-binding phosphoprotein 50 in retinal pigment epithelium. Invest Ophthalmol Vis Sci. 2004;45(2)393–401.[Abstract/Free Full Text]
- Nawrot M, Liu T, Garwin GG, Crabb JW, Saari JC. Scaffold proteins and the regeneration of visual pigments. Photochem Photobiol. 2006;82(6)1482–1488.[Web of Science][Medline][Order article via Infotrieve]
- Saari JC, Bredberg DL, Noy N. Control of substrate flow at a branch in the visual cycle. Biochemistry. 1994;33(10)3106–3112.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Burstedt MS, Sandgren O, Holmgren G, Forsman-Semb K. Bothnia dystrophy caused by mutations in the cellular retinaldehyde-binding protein gene (RLBP1) on chromosome 15q26. Invest Ophthalmol Vis Sci. 1999;40(5)995–1000.[Abstract/Free Full Text]
- Morimura H, Berson EL, Dryja TP. Recessive mutations in the RLBP1 gene encoding cellular retinaldehyde-binding protein in a form of retinitis punctata albescens. Invest Ophthalmol Vis Sci. 1999;40(5)1000–1004.[Abstract/Free Full Text]
- Maw MA, Kennedy B, Knight A, et al. Mutation of the gene encoding cellular retinaldehyde-binding protein in autosomal recessive retinitis pigmentosa. Nat Genet. 1997;17(2)198–200.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Saari JC, Crabb JW. Focus on molecules: cellular retinaldehyde-binding protein (CRALBP). Exp Eye Res. 2005;81(3)245–246.[Web of Science][Medline][Order article via Infotrieve]
- Saari JC, Nawrot M, Kennedy BN, et al. Visual cycle impairment in cellular retinaldehyde binding protein (CRALBP) knockout mice results in delayed dark adaptation. Neuron. 2001;29(3)739–748.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Stecher H, Gelb MH, Saari JC, Palczewski K. Preferential release of 11-cis-retinol from retinal pigment epithelial cells in the presence of cellular retinaldehyde-binding protein. J Biol Chem. 1999;274(13)8577–8585.[Abstract/Free Full Text]
- Winston A, Rando RR. Regulation of isomerohydrolase activity in the visual cycle. Biochemistry. 1998;37(7)2044–2050.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Mata NL, Radu RA, Clemmons RC, Travis GH. Isomerization and oxidation of vitamin a in cone-dominant retinas: a novel pathway for visual-pigment regeneration in daylight. Neuron. 2002;36(1)69–80.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Mata NL, Ruiz A, Radu RA, Bui TV, Travis GH. Chicken retinas contain a retinoid isomerase activity that catalyzes the direct conversion of all-trans-retinol to 11-cis-retinol. Biochemistry. 2005;44(35)11715–11721.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Trevino SG, Villazana-Espinoza ET, Muniz A, Tsin AT. Retinoid cycles in the cone-dominated chicken retina. J Exp Biol. 2005;208:4151–4157.[Abstract/Free Full Text]
- Muniz A, Villazana-Espinoza ET, Thackeray B, Tsin AT. 11-cis-Acyl-CoA:retinol O-acyltransferase activity in the primary culture of chicken Muller cells. Biochemistry. 2006;45(40)12265–12273.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Villazana-Espinoza ET, Hatch AL, Tsin AT. Effect of light exposure on the accumulation and depletion of retinyl ester in the chicken retina. Exp Eye Res. 2006;83(4)871–876.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Westerfield M. Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio rerio). 2007; 5th ed. University of Oregon Press Eugene, OR.
- Hubbard T, Barker D, Birney E, et al. The Ensembl genome database project. Nucleic Acids Res. 2002;30:38–41.[Abstract/Free Full Text]
- Barthel LK, Raymond PA. Subcellular localization of alpha-tubulin and opsin mRNA in the goldfish retina using digoxigenin-labeled cRNA probes detected by alkaline phosphatase and HRP histochemistry. J Neurosci Methods. 1993;50(2)145–152.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Larison KD, Bremiller R. Early onset of phenotype and cell patterning in the embryonic zebrafish retina. Development. 1990;109(3)567–576.[Abstract]
- Brockerhoff SE, Hurley JB, Janssen-Bienhold U, Neuhauss SC, Driever W, Dowling JE. A behavioral screen for isolating zebrafish mutants with visual system defects. Proc Natl Acad Sci U S A. 1995;92(23)10545–10549.[Abstract/Free Full Text]
- Amores A, Force A, Yan YL, et al. Postlethwait. Zebrafish hox clusters and vertebrate genome evolution. Science. 1998;282(5394)1711–1714.[Abstract/Free Full Text]
- Nawrot M, Liu T, Garwin GG, Crabb JW, Saari JC. Scaffold proteins and visual pigment regeneration. Photochem Photobiol. 2006;82(6)1482–1488.[Web of Science][Medline][Order article via Infotrieve]
- Kong YH, Ye GM, Qu K, et al. Cloning and characterization of a novel, human cellular retinaldehyde-binding protein CRALBP-like (CRALBPL) gene. Biotechnol Lett. 2006;28(17)1327–1333.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Gamse JT, Thisse C, Thisse B, Halpern ME. The parapineal mediates left-right asymmetry in the zebrafish diencephalon. Development. 2003;130(6)1059–1068.[Abstract/Free Full Text]
- Gothilf Y, Coon SL, Toyama R, Chitnis A, Namboodiri MA, Klein DC. Zebrafish serotonin N-acetyltransferase-2: marker for development of pineal photoreceptors and circadian clock function. Endocrinology. 1999;140(10)4895–4903.[Abstract/Free Full Text]
- Bernardos RL, Raymond PA. GFAP transgenic zebrafish. Gene Expr Patterns. 2006;6:1007–1013.[CrossRef][Medline][Order article via Infotrieve]
- Raymond PA, Barthel LK, Bernardos RL, Perkowski JJ. Molecular characterization of retinal stem cells and their niches in adult zebrafish. BMC Dev Biol. 2006;6:36.[CrossRef][Medline][Order article via Infotrieve]
- Eisenfeld AJ, Bunt-Milam AH, Saari JC. Immunocytochemical localization of retinoid-binding proteins in developing normal and RCS rats. Prog Clin Biol Res. 1985;190:231–240.[Medline][Order article via Infotrieve]
- Martin-Alonso JM, Ghosh S, Hernando N, Crabb JW, Coca-Prados M. Differential expression of the cellular retinaldehyde-binding protein in bovine ciliary epithelium. Exp Eye Res. 1993;56(6)659–669.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Branchek T, Bremiller R. The development of photoreceptors in the zebrafish, Brachydanio rerio. I. Structure. J Comp Neurol. 1984;224(1)107–115.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Crabb JW, Carlson A, Chen Y, et al. Structural and functional characterization of recombinant human cellular retinaldehyde-binding protein. Protein Sci. 1998;7(3)746–757.[Web of Science][Medline][Order article via Infotrieve]
- Hattar S, Liao HW, Takao M, Berson DM, Yau KW. Melanopsin-containing retinal ganglion cells: architecture, projections, and intrinsic photosensitivity. Science. 2002;295(5557)1065–1070.[Abstract/Free Full Text]
- Kennedy BN, Li C, Ortego J, Coca-Prados M, Sarthy VP, Crabb JW. CRALBP transcriptional regulation in ciliary epithelial, retinal Muller and retinal pigment epithelial cells. Exp Eye Res. 2003;76(2)257–260.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Allwardt BA, Dowling JE. The pineal gland in wild-type and two zebrafish mutants with retinal defects. J Neurocytol. 2001;30(6)493–501.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Holm PC, Mader MT, Haubst N, Wizenmann A, Sigvardsson M, Götz M. Loss- and gain-of-function analyses reveal targets of Pax6 in the developing mouse telencephalon. Mol Cell Neurosci. 2007;34:99–119.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Nomura T, Haba H, Osumi N. Role of a transcription factor Pax6 in the developing vertebrate olfactory system. Dev Growth Differ. 2007;49(9)683–690.[Web of Science][Medline][Order article via Infotrieve]
- Collinson JM, Quinn JC, Hill RE, West JD. The roles of Pax6 in the cornea, retina, and olfactory epithelium of the developing mouse embryo. Dev Biol. 2003;255(2)303–312.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Hicks D, Sahel J. The implications of rod-dependent cone survival for basic and clinical research. Invest Ophthalmol Vis Sci. 1999;40(13)3071–3074.[Free Full Text]
- Saari JC, Bredberg L, Garwin GG. Identification of the endogenous retinoids associated with three cellular retinoid-binding proteins from bovine retina and retinal pigment epithelium. J Biol Chem. 1982;257(22)13329–13333.[Abstract/Free Full Text]
- Jones GJ, Crouch RK, Wiggert B, Cornwall MC, Chader GJ. Retinoid requirements for recovery of sensitivity after visual-pigment bleaching in isolated photoreceptors. Proc Natl Acad Sci U S A. 1989;86(23)9606–9610.[Abstract/Free Full Text]
- Vogel JS, Bullen EC, Teygong CL, Howard EW. Identification of the RLBP1 gene promoter. Invest Ophthalmol Vis Sci. 2007;48(8)3872–3977.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
P. K. Yu, C. Balaratnasingam, W. H. Morgan, S. J. Cringle, I. L. McAllister, and D.-Y. Yu
The Structural Relationship between the Microvasculature, Neurons, and Glia in the Human Retina
Invest. Ophthalmol. Vis. Sci.,
January 1, 2010;
51(1):
447 - 458.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. G. Kusakabe, N. Takimoto, M. Jin, and M. Tsuda
Evolution and the origin of the visual retinoid cycle in vertebrates
Phil Trans R Soc B,
October 12, 2009;
364(1531):
2897 - 2910.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. R. Vazquez-Chona, A. M. Clark, and E. M. Levine
Rlbp1 Promoter Drives Robust Muller Glial GFP Expression in Transgenic Mice
Invest. Ophthalmol. Vis. Sci.,
August 1, 2009;
50(8):
3996 - 4003.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. V. Cideciyan, T. S. Aleman, S. L. Boye, S. B. Schwartz, S. Kaushal, A. J. Roman, J.-j. Pang, A. Sumaroka, E. A. M. Windsor, J. M. Wilson, et al.
Human gene therapy for RPE65 isomerase deficiency activates the retinoid cycle of vision but with slow rod kinetics
PNAS,
September 30, 2008;
105(39):
15112 - 15117.
[Abstract]
[Full Text]
[PDF]
|
 |
|