IOVS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1167/iovs.07-1610 on April 17, 2008
 (Investigative Ophthalmology and Visual Science. 2008;49:3955-3960.)
© 2008 by The Association for Research in Vision and Ophthalmology, Inc.
doi:10.1167/iovs.07-1610
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
iovs.07-1610v1
49/9/3955    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Meyer-ter-Vehn, T.
Right arrow Articles by Schlunck, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meyer-ter-Vehn, T.
Right arrow Articles by Schlunck, G.

Lovastatin Inhibits TGF-β–Induced Myofibroblast Transdifferentiation in Human Tenon Fibroblasts

Tobias Meyer-ter-Vehn,* Barbara Katzenberger, Hong Han, Franz Grehn, and Günther Schlunck*

From the Department of Ophthalmology, University of Würzburg, Würzburg, Germany.


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. The transdifferentiation of Tenon fibroblasts to myofibroblasts is a pivotal step in filtering bleb scarring. It is mediated by the cytokine TGF-β, Rho-dependent contractility, and cell–matrix interactions in an interdependent fashion. HMG-CoA-reductase inhibitors (statins) have been shown to inhibit Rho-GTPase signaling; therefore, the authors studied the influence of lovastatin on TGF-β–mediated myofibroblast transdifferentiation to assess the potential use of statins in wound healing modulation.

METHODS. Human Tenon fibroblasts were grown in culture, pretreated with lovastatin, lovastatin and mevalonate, or specific inhibitors of farnesyl transferase or geranylgeranyl transferase and were stimulated with TGF-β1. {alpha}-Smooth muscle actin ({alpha}-SMA) and connective tissue growth factor (CTGF) transcription were assessed by real-time PCR. {alpha}-SMA protein expression and localization were studied by Western blot and confocal immunofluorescence microscopy. Cell contractility was determined in collagen gel contraction assays. Phosphorylation of the signaling proteins Smad-2/3 and p38 were detected by Western blot, and Smad-2/3 localization was determined by confocal immunofluorescence microscopy.

RESULTS. Lovastatin inhibited TGF-β–induced CTGF transcription, {alpha}-SMA expression and incorporation into actin stress fibers, and subsequent collagen gel contraction. These effects were reversed by mevalonate. The inhibition of geranylgeranyl transferase but not farnesyl transferase blocked TGF-β–induced {alpha}-SMA expression. Lovastatin decreased TGF-β–induced p38 activation, whereas Smad-2/3 phosphorylation and nuclear translocation were preserved.

CONCLUSIONS. Lovastatin inhibits TGF-β–induced myofibroblast transdifferentiation in human Tenon fibroblasts, most likely by interfering with Rho-signaling. Statins may, therefore, serve to inhibit scarring after filtering glaucoma surgery.

Postoperative scar formation is a serious problem in filtering glaucoma surgery. Current strategies to counteract scarring include local antimetabolite treatment, which is associated with severe side effects, limiting its application.1 Therefore, additional means to safely modulate wound healing are desirable, and distinct molecular mediators of the scarring process may provide valuable targets for novel therapeutic approaches.

The cytokine TGF-β is a key mediator of wound healing and is critically involved in postoperative scarring.2 3 On the cellular level, TGF-β drives the conversion of fibroblasts to myofibroblasts as a key step in all fibrotic processes.4 This transdifferentiation is characterized by the de novo synthesis of {alpha}-smooth muscle actin ({alpha}-SMA),5 the incorporation of {alpha}-SMA into stress fibers, and the subsequent increase in cell contractility.6 7 Myofibroblasts are necessary for sufficient wound closure8 but usually disappear at late stages of wound healing.9 The persistence of myofibroblasts is associated with increased deposition of ECM proteins,10 11 leading to tissue fibrosis. Therefore, TGF-β is a major target of evolving antifibrotic strategies; approaches have been made using scavenging antibodies,12 13 endogenous antagonists,14 and nucleotide-based methods.15 Intracellular signaling pathways downstream of TGF-β may also offer therapeutic options, and inhibition of p38- or Rho-dependent signaling was shown to inhibit myofibroblast transdifferentiation in vitro.16 17

Statins inhibit the enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase and are widely used to decrease plasma cholesterol and lipoprotein levels with beneficial effects in occlusive vascular disease.18 19 Besides their effect on plasma lipid concentrations, statins influence distinct intracellular signal transduction processes. Several signaling molecules, such as Rho-family GTPases, translocate to the plasma membrane on activation. These molecules require an isoprenyl lipid anchor domain to attach to the inner leaflet of the plasma membrane and engage downstream signaling. Because isoprenyl groups are derived from cholesterol precursors, an inhibition of cholesterol precursor synthesis impedes isoprenyl-dependent signaling.20 21 Thus, statins also exert pleiotropic effects, such as the inhibition of Rho signaling, that are not directly related to lowering lipoprotein plasma levels. Pleiotropic effects account for a range of beneficial properties such as immunomodulation20 21 and enhanced nitrous oxide activity22 observed with statin use.

Here we report that lovastatin prevents TGF-β–induced myofibroblast transdifferentiation in human Tenon fibroblasts on a structural and functional level. This effect is specific because it is reversed by the addition of mevalonate, the product of HMG-CoA enzyme activity. Furthermore, the inhibition of geranylgeranyl transferase, but not of farnesyl transferase, blocks TGF-β–induced {alpha}-SMA synthesis, suggesting the involvement of small Rho-family GTPases in the lovastatin effect. Thus, statins may provide a novel approach to counteract postoperative scarring in glaucoma surgery.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Reagents
A total RNA purification kit (RNeasy) and RNase-free DNase were purchased from Qiagen (Hilden, Germany), Taq polymerase was purchased from Promega (Mannheim, Germany), and reverse transcriptase (Superscript II) was purchased from Invitrogen (Karlsruhe, Germany). Antibodies raised against the following proteins were used: {alpha}-SMA, tubulin (Sigma, St. Louis, MO), active p38 (Promega), total p38 (NEB, Frankfurt, Germany), active Smad-2/3 (Zymed/Zytomed, Berlin, Germany), total Smad-2/3 (Chemicon, Temecula, CA), conjugated goat anti-mouse (Alexa-488; Molecular Probes, Eugene, OR), and horseradish peroxidase-conjugated secondary antibodies (Jackson/Dianova, Hamburg, Germany). Recombinant TGF-β1 was obtained from Tebu-Bio (Offenbach, Germany) and was used at 2 ng/mL (final concentration) in all experiments. Lovastatin and mevalonate were from Sigma, and FTI 287 and GGTI 286 were purchased from Merck Biosciences (Bad Soden, Germany).

Cell Culture
Small Tenon biopsy samples were obtained during standard intraocular surgery after comprehensive information and written consent of selected patients. The tenets of the Declaration of Helsinki were followed, and institutional ethics committee approval was granted. Primary human Tenon fibroblasts (HTF) were gained as an expansion culture of the human Tenon explants and propagated in Dulbecco’s modified Eagle medium (DMEM; PAA Laboratories GmbH, Pasching, Austria) supplemented with 10% heat-inactivated fetal calf serum (Biochrom, Berlin, Germany), 100 U/mL penicillin, and 100 µg/mL streptomycin (both PAA Laboratories). Cells were maintained in the logarithmic growth phase. For all experiments, cells from passages 3 to 6 were used. All experiments were performed at least three times with similar results.

Lovastatin and Transferase Inhibitors
Lovastatin (Sigma) was dissolved in ethanol. It was converted from its inactive lactone form to its active dihydroxyl open acid form by the addition of 4 vol lovastatin dissolved in ethanol to 6 vol 0.1 N NaOH, incubation for 1 hour at 50°C, and subsequent neutralization with 1 N HCl to pH 7.2. Stock solutions (10 mM) of FTI 277 and GGTI 286 were prepared in dimethyl sulfoxide. The inhibitors were diluted in unsupplemented DMEM, added to the cell culture 16 hours (lovastatin) or 30 minutes (transferase inhibitors) before TGF-β stimulation, and were present with the stimuli as indicated.

RNA Isolation and Real-Time Reverse Transcription–Polymerase Chain Reaction
HTFs were plated in 60-mm cell culture dishes at 2 x 105 cells/dish, serum-starved, and pretreated with vehicle, lovastatin, or lovastatin and mevalonate for 16 hours. Subsequently they were stimulated with TGF-β for various intervals. Total RNA was harvested using spin columns (RNeasy; Qiagen), according to manufacturer’s recommendations. To eliminate contamination with genomic DNA, DNase digestion was performed for 15 minutes. First-strand cDNA was synthesized by reverse transcriptase (Superscript II; Invitrogen, Karlsruhe, Germany) at 42°C using 500 ng total RNA extract.

Real-time RT-PCR was conducted in a 96-well microtiter plate with a total reaction volume of 25 µL containing 2 µL of a 1:4 dilution of first-strand reaction product, 0.4 µM specific upstream and downstream primers, 240 µM dNTP-mix, 1x reaction buffer, Taq polymerase, and SYBR-green (Sigma-Aldrich) as a fluorescent marker. Amplification of cDNA fragments and analysis were carried out (iCycler; Bio-Rad, München, Germany). Cycling conditions were initial denaturation at 95°C for 3 minutes followed by 40 cycles consisting of a 15-second denaturation interval and 1-minute intervals for annealing and primer extension at 60°C. Amplification of the housekeeping gene hypoxanthine-guanine-phosphoribosyl transferase 1 (HPRT1) mRNA transcript, which served as a normalization standard, was carried out with HPRT1 forward (GACCAGTCAACAGGGGACAT) and HPRT1 reverse (ACACTTCGTGGGGTCCTTTT) primers. Side-strand–specific primers for {alpha}-SMA and connective tissue growth factor (CTGF) were {alpha}-SMA forward (CTGTTCCAGCCATCCTTCAT), {alpha}-SMA reverse (CCGTGATCTCCTTCTGCATT), CTGF forward (CCTGGTCCAGACCACAGAGT), and CTGF reverse (TGGAGATTTTGGGAGTACGG). {alpha}-SMA and CTGF mRNA levels were measured as CT threshold levels and normalized with the individual HPRT1 control CT values.

Western Blot
Cells were rinsed with ice-cold PBS, and total cell protein extracts were prepared using a TNE lysis buffer (20 mM Tris, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100) containing phosphatase inhibitors (1 mM sodium vanadate, 50 mM NaF) and protease inhibitors (0.1% phenylmethylsulfonyl fluoride; Complete Protease Inhibitor, Roche). Protein concentrations were measured by a BCA assay (KMF, Lohmar, Germany). Ten micrograms of protein extracts were boiled in Laemmli sample buffer and subjected to SDS polyacrylamide gel electrophoresis. Proteins were transferred onto a polyvinylidene difluoride membrane (Amersham, Braunschweig, Germany) using a gel-blotting apparatus (Bio-Rad). Membranes were blocked in 3% BSA in TBST (10 mM Tris HCl [pH 7.4], 150 mM NaCl, 0.1% Tween 20) for 1 hour. Membranes were incubated with primary antibody overnight at 4°C and with a peroxidase-conjugated secondary antibody for 45 minutes at room temperature. After each incubation step, membranes were washed in TBST for 20 minutes. Peroxidase was visualized by enhanced chemiluminescence (ECL; Amersham) and exposure to ECL film (Hyperfilm; Amersham) for appropriate times.

Immunofluorescence Confocal Microscopy
Glass coverslips were coated with fibronectin (10 µg/mL) for 1 hour at 37°C and washed with PBS. HTF cells were then plated in FCS-supplemented DMEM and incubated for 24 hours to allow efficient attachment. Cells were serum-deprived and pretreated with vehicle, lovastatin, or lovastatin and mevalonate for 16 hours and subsequently were stimulated with TGF-β (2 ng/mL) for 3 days. Cells were fixed in 2% paraformaldehyde, permeabilized in 0.2% Triton X-100, blocked in 2% normal goat serum (Jackson-Immuno, Hamburg, Germany), and labeled with primary antibody against {alpha}-SMA at a dilution of 1:400 in blocking buffer. Conjugated secondary antibody (Alexa-488; Molecular Probes) against mouse IgG was used at a 1:500 dilution in blocking buffer. Rhodamine-phalloidin was used to counterstain the F-actin cytoskeleton. Cells were viewed with a laser scanning confocal microscope (TCS SP-2; Leica Microsystems, Bensheim, Germany).

Fixed Collagen Gel Cultures
Experiments were conducted essentially as described by Grinnell et al.23 Briefly, 24-well plates were precoated with 0.2% BSA (KMF) for 1 hour. HTF resuspended in DMEM supplemented with 0.2% FCS was added to a neutralized collagen solution (16 parts Vitrogen-100 [Cohesion, Invitrogen, Palo Alto, CA], 2 parts 10x DMEM [Sigma], 1 part NaHCO3 [Sigma]) in a 1:1 ratio, yielding a final concentration of 150,000 cells/mL and 1.2 mg/mL collagen.

Collagen cell suspension was added to each well and incubated at 37°C for 1 hour for polymerization. Gels were preincubated with vehicle, lovastatin, or lovastatin and mevalonate for 16 hours. After 48-hour stimulation with TGF-β1 (2 ng/mL), gels were detached, and contraction was digitally photo-documented after 3 hours. Contraction quantification was performed using NIH image software (rsb.info.nih.gov/nih-image/Default.html).


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
Lovastatin Inhibits TGF-β–Induced Smooth Muscle Actin Expression
To assess the effect of statins on TGF-β–induced myofibroblast transdifferentiation, we measured TGF-β–induced {alpha}-SMA mRNA (Fig. 1A) and protein (Fig. 1B) levels in the presence or absence of lovastatin (10 µM) and mevalonate (500 µM), respectively. In the absence of lovastatin, TGF-β led to a robust increase in {alpha}-SMA mRNA and protein expression after 24 and 48 hours of stimulation (Figs. 1A 1B) . Lovastatin strongly diminished the TGF-β–induced increase of {alpha}-SMA mRNA and protein levels. Addition of mevalonate, the product of HMG-CoA-reductase, reversed the lovastatin effect (Figs. 1A 1C) .


Figure 1
View larger version (30K):
[in this window]
[in a new window]

  		FIGURE 1. Effect of lovastatin and mevalonate on TGF-β–induced {alpha}-SMA expression. HTFs were serum-starved overnight and incubated with vehicle, 10 µM lovastatin, or 10 µM lovastatin and 500 µM mevalonate for 16 hours and consecutively stimulated with TGF-β for the times indicated. The expressions of {alpha}-SMA mRNA (A) and protein (B, C) were analyzed by real-time RT-PCR and Western blot, respectively. Lovastatin blocked TGF-β–induced {alpha}-SMA expression, whereas mevalonate reversed the lovastatin effect (C).

 
Lovastatin Impedes TGF-β–Induced {alpha}-SMA Recruitment to Stress Fibers
Incorporation of {alpha}-SMA into actin stress fibers is a characteristic feature of myofibroblast differentiation, enabling the cells to exert increased contractile activity.4 24 25 We visualized the effect of lovastatin on TGF-β–induced {alpha}-SMA recruitment by confocal immunofluorescence microscopy. In untreated control fibroblasts, predominantly cortical F-actin staining was detected with a few intracellular stress fibers and a weak diffuse cytoplasmic {alpha}-SMA signal 48 hours after plating on fibronectin (Fig. 2A) . TGF-β induced pronounced actin stress fiber formation, with recruitment of {alpha}-SMA to stress fibers in approximately 50% of the cells (Fig. 2D) . In contrast, lovastatin-treated cells showed a faint diffuse F-actin signal with almost no stress fibers and very weak cytoplasmic staining for {alpha}-SMA (Fig. 2B) . In the presence of lovastatin, TGF-β treatment resulted in a mild enhancement of the actin cytoskeleton with few stress fibers, but {alpha}-SMA incorporation into stress fibers was not observed (Fig. 2E) . Addition of mevalonate reversed the lovastatin effect, indicating a specific effect of HMG-CoA reductase inhibition. However, {alpha}-SMA recruitment to stress fibers was less pronounced than in TGF-β controls (Figs. 2C 2F) .


Figure 2
View larger version (67K):
[in this window]
[in a new window]

  		FIGURE 2. Lovastatin prevents the recruitment of {alpha}-SMA to actin stress fibers. HTFs were preincubated with vehicle (A, D), 10 µM lovastatin (B, E), or 10 µM lovastatin and 500 µM mevalonate (C, F) for 16 hours and were consecutively stimulated with TGF-β for 3 days. {alpha}-SMA and F-actin localization were detected by confocal immunofluorescence microscopy. Untreated cells expressed little {alpha}-SMA, which was predominantly localized in the perinuclear region (A–C). TGF-β induced {alpha}-SMA expression and recruitment to actin stress fibers in most cells (D). In the presence of lovastatin, TGF-β treatment failed to recruit {alpha}-SMA into stress fibers (E). Adding mevalonate to lovastatin treatment partially restored TGF-β–induced incorporation of {alpha}-SMA into stress fibers (F). Scale bar, 40 µm.

 
Lovastatin Prevents TGF-β–Induced Contraction in Fibroblast-Populated Collagen Gels
To explore the functional effects of lovastatin on TGF-β–induced myofibroblast transdifferentiation, we assessed cell contractility in tethered fibroblast-populated collagen gels. HTFs were plated in neutralized collagen solution, pretreated with vehicle, lovastatin, or lovastatin and mevalonate for 16 hours, and stimulated with TGF-β (2 ng/mL). Two days later, the gels were released, and subsequent gel contraction was determined after 3 hours (Figs. 3A 3B) . Untreated gels contracted to 47% of their initial size, and TGF-β strongly increased contractility (27% of initial gel size). Lovastatin blocked the TGF-β–induced increase in contractility (48% of initial gel size), whereas the addition of mevalonate abolished the inhibitory effect of lovastatin (27% of initial gel size). Thus, lovastatin prevented the TGF-β–induced emergence of a myofibroblast phenotype on structural and functional levels. This effect was mediated by specific inhibition of HMG-CoA reductase because it was reversed by the addition of the HMG-CoA product mevalonate.


Figure 3
View larger version (55K):
[in this window]
[in a new window]

  		FIGURE 3. Lovastatin blocks TGF-β–induced contraction of fibroblast-populated collagen gels. HTFs were seeded in neutralized collagen solution and preincubated with vehicle, 10 µM lovastatin, or 10 µM lovastatin and 500 µM mevalonate for 16 hours and were consecutively stimulated with TGF-β (2 ng/mL) for 2 days. Gels were detached, and subsequent gel contraction was digitally photodocumented (A) and measured as a reduction in gel surface area 3 hours after detachment (B).

 
Lovastatin Inhibits TGF-β–Induced CTGF Expression
CTGF is an important mediator downstream of TGF-β, with implications in myofibroblast transdifferentiation.26 Its expression is induced by TGF-β and is increased in a rabbit model of filtering-glaucoma surgery.27 We, therefore, examined the effect of lovastatin on TGF-β–induced CTGF mRNA expression. TGF-β stimulation elicited a robust increase in CTGF mRNA, and lovastatin blocked this effect in a dose-dependent manner (Fig. 4) . The addition of mevalonate rescued CTGF mRNA expression in the presence of 40 µM lovastatin.


Figure 4
View larger version (16K):
[in this window]
[in a new window]

  		FIGURE 4. Lovastatin impairs TGF-β–induced CTGF expression. HTFs were serum-starved and incubated with vehicle, different concentrations of lovastatin, or 40 µM lovastatin and 500 µM mevalonate for 16 hours. Subsequently, cells were stimulated with TGF-β for 24 hours, and CTGF expression was measured by quantitative RT-PCR. Lovastatin blocked TGF-β–induced CTGF expression in a dose-dependent manner. Mevalonate reversed the inhibitory effect of 40 µM lovastatin.

 
Lovastatin Attenuates TGF-β–Induced p38 Activation
We recently observed that p38 signaling is critical for TGF-β–driven myofibroblast transdifferentiation.16 To investigate a possible effect of lovastatin on TGF-β–dependent signal transduction, we studied p38 and Smad-2/3 activation in the presence of lovastatin at various concentrations. TGF-β induced phosphorylation of a small p38 isoform (Fig. 5A , arrow) after 24 and 48 hours that was attenuated by lovastatin in a dose-dependent manner. The activation of p38 at 24 hours was slightly reduced in the presence of 10 µM lovastatin. At concentrations of 20 µM and 40 µM, lovastatin significantly blocked p38 activation (Fig. 5A) . In contrast, sustained Smad-2/3 phosphorylation at 24 hours was unaffected by lovastatin, even at 40 µM. In addition, nuclear translocation of Smad-2/3 on TGF-β stimulation, another characteristic for activated SMAD signaling, was not altered by lovastatin (Figs. 5B 5C 5D 5E) .


Figure 5
View larger version (65K):
[in this window]
[in a new window]

  		FIGURE 5. Lovastatin attenuates TGF-β–induced p38 activation but does not affect Smad signaling. HTFs were preincubated with vehicle or 10 µM, 20 µM, or 40 µM lovastatin and were consecutively treated with TGF-β for the indicated times. The phosphorylation of p38, and Smad-2/3 was detected by Western blot using phosphospecific antibodies. Although lovastatin attenuated TGF-β–induced activation of p38 (A), Smad-2/3 phosphorylation was unaffected (B). Smad-2/3 translocation to the nucleus on TGF-β stimulation (E, F) was not affected by 10 µM lovastatin, as visualized by confocal immunofluorescence microscopy.

 
Geranylgeranyl Transferase Inhibitors, but Not Farnesyl Transferase Inhibitors, Block TGF-β–Induced {alpha}-SMA Expression
To gain further insight into the possible mechanism of lovastatin-mediated inhibition of myofibroblast transdifferentiation, we studied the contribution of different posttranslational protein prenylation pathways. Statins block mevalonate synthesis and impede the synthesis of cholesterol and other isoprenoid derivatives, such as geranylgeranyl pyrophosphate or farnesyl pyrophosphate, which serve as lipid anchors for small G-proteins. Geranylgeranyl pyrophosphate is attached to Rho-family GTPases essential in cytoskeletal signaling and intracellular membrane transport. Posttranslational isoprenylation is mandatory for their proper functioning.28 Inhibition of geranylgeranyl transferase by a specific inhibitor (GGTI 286) caused a dose-dependent decrease of TGF-β–induced {alpha}-SMA expression (Fig. 6) , whereas inhibition of farnesyl transferase using FTI-277 had no effect (Fig. 6) . Given that Rho-GTPase signaling is critical in TGF-β–driven myofibroblast transdifferentiation,17 this result suggests a block of Rho-geranylgeranylation as a relevant mechanism.


Figure 6
View larger version (21K):
[in this window]
[in a new window]

  		FIGURE 6. GGTI, but not FTI, blocks TGF-β–induced SMA expression. HTFs were treated with TGF-β for 3 days in the presence of vehicle, FTI, or GGTI in different concentrations. {alpha}-SMA expression was measured by Western blot. Although GGTI impeded TGF-β–induced {alpha}-SMA expression, FTI did not.

 

   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
Subconjunctival scarring remains the most severe problem in filtering glaucoma surgery. Conversion of fibroblasts to myofibroblasts, the cellular protagonists of fibrosis, requires the cytokine TGF-β and cellular contractility.17 Recent studies highlight the significance of pleiotropic effects of statins, such as inhibition of Rho-GTPase signaling, with subsequent cytoskeletal relaxation distinct from the effects on plasma cholesterol and lipoprotein levels.29 In light of these findings, we assessed the effect of lovastatin on TGF-β–induced myofibroblast transdifferentiation. Our data indicate that lovastatin blocks this process in human Tenon fibroblasts by the inhibition of posttranslational isoprenylation.

To evaluate a possible influence of statins on TGF-β–induced structural changes in human Tenon fibroblasts, we first assessed the expression of the myofibroblast marker {alpha}-SMA. Lovastatin inhibited the TGF-β–induced expression of {alpha}-SMA on mRNA and protein levels (Figs. 1A 1B) . In the presence of lovastatin, TGF-β–induced {alpha}-SMA expression was rescued by the addition of mevalonate, the product of HMG-CoA reductase (Figs. 1A 1C) . This result suggests that the blocking effect of lovastatin is caused by specific inhibition of mevalonate synthesis rather than other known possible mechanisms, such as extracellular binding to adhesion molecules.30 Our data are supported by other studies reporting the inhibition of TGF-β–induced {alpha}-SMA expression in atrial fibroblasts31 and lung fibroblasts.32 Moreover, {alpha}-SMA expression seen in renal interstitial fibrosis after unilateral urethral obstruction in a rat model was reduced by statin application.33

In addition to the protein expression level, the subcellular localization of {alpha}-SMA is critical for the acquisition of a myofibroblast phenotype because {alpha}-SMA recruitment to actin stress fibers is required to enhance cell contractility.34 Therefore, we studied {alpha}-SMA localization by confocal immunofluorescence microscopy. Lovastatin blocked the TGF-β–induced incorporation of {alpha}-SMA into actin stress fibers (Fig. 2D) and prevented enhancement of the F-actin cytoskeleton. Both these effects were reversed by the addition of mevalonate (Fig. 2F) .

To explore the influence of lovastatin in a functional assay, we measured the contraction of tethered fibroblast-populated collagen gels.35 Increased gel contraction exerted by TGF-β–treated fibroblasts was abrogated by lovastatin and rescued by additional application of mevalonate (Fig. 3) . Consistent with these findings, the inhibition of TGF-β–induced gel contraction by lovastatin has been observed in kidney36 and lung fibroblasts.32

CTGF acts as an important mediator of scarring processes downstream of TGF-β.37 In addition to its effects on SMA expression, lovastatin also inhibited TGF-β–induced CTGF expression (Fig. 4) . These results are in line with previous observations in renal and lung fibroblasts.32 38

Next, we focused on the influence of lovastatin on TGF-β–mediated signal transduction. Lovastatin reduced TGF-β–induced p38 activation, whereas Smad-2/3 phosphorylation and nuclear translocation were unaffected (Fig. 4) . These data are reminiscent of the effects observed with inhibitors of the Rho-dependent kinase ROCK, which blocked cell contraction, p38 activation, and {alpha}-SMA expression to inhibit myofibroblast transdifferentiation,17 suggesting a related mechanism of action. Several pleiotropic effects of statins were attributed to an inhibition of Rho-GTPase signaling: Lovastatin impaired HIV entry into mononuclear blood cells by blocking Rho signaling.39 Similarly, statins blocked plasma membrane translocation of Rho in cardiac myofibroblasts,40 and the TGF-β–induced expression of CTGF and {alpha}-SMA by inhibiting Rho function.32 38 In the eye, statins were shown to induce trabecular meshwork cell relaxation and a hypotensive response in an anterior chamber perfusion model by interfering with Rho-GTPase function.41 These pleiotropic statin effects are attributed mainly to interference with mevalonate-dependent isoprenoid metabolism.20 21 The isoprenoids geranylgeranyl pyrophosphate and farnesyl-pyrophosphate serve as lipid anchor domains and allow protein attachment to the inner leaflet of the plasma membrane. Posttranslational addition of a geranylgeranyl domain is mandatory for the correct localization and function of the small GTPase Rho, which is a master regulator of the actin cytoskeleton and governs cell contractility.28 In our system, the effect of lovastatin was mimicked by the inhibition of geranylgeranyl transferase, which averted TGF-β–induced {alpha}-SMA expression, whereas the inhibition of farnesyl transferase had no effect. These data are compatible with a lovastatin-induced inhibition of Rho signaling in human Tenon fibroblasts.

Several beneficial ocular effects of statins have been suggested: statins reduce the risk for nuclear cataracts42 43 and the development of indistinct soft drusen,44 and they may have the potential to decrease outflow resistance.41 Our data indicate that lovastatin prevents TGF-β–induced myofibroblast transdifferentiation in human Tenon fibroblasts in vitro. This effect is mediated by specific inhibition of mevalonate synthesis and most likely the result of a subsequent block of Rho-GTPase isoprenylation. Statins may, therefore, serve as safe adjuvant drugs to modulate wound healing and to prevent postoperative scarring after filtering glaucoma surgery.


   Acknowledgements
 
The authors thank Michael Sendtner and his group at the Institute for Clinical Neurobiology, Würzburg, for generously sharing equipment.


   Footnotes
 
Supported by Interdisziplinäres Zentrum für Klinische Forschung Grant A-41.

Submitted for publication December 16, 2007; revised March 31, 2008; accepted June 23, 2008.

Disclosure: T. Meyer-ter-Vehn, None; B. Katzenberger, None; H. Han, None; F. Grehn, None; G. Schlunck, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

* Each of the following is a corresponding author: Tobias Meyer-ter-Vehn, Department of Ophthalmology, University of Würzburg, Joseph Schneider Strasse 2, D 97080, Würzburg, Germany; meyer_T3{at}augenklinik.uni-wuerzburg.de. Günther Schlunck, Department of Ophthalmology, University of Würzburg, Joseph Schneider Strasse 2, D 97080, Würzburg, Germany; schlunck_g{at}klinik.uni-wuerzburg.de. Back


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Lama PJ, Fechtner RD. Antifibrotics and wound healing in glaucoma surgery. Surv Ophthalmol. 2003;48(3)314–346.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  2. Cordeiro MF, Siriwardena D, Chang L, Khaw PT. Wound healing modulation after glaucoma surgery. Curr Opin Ophthalmol. 2000;11(2)121–126.[CrossRef][Medline][Order article via Infotrieve]
  3. Cordeiro MF. Role of transforming growth factor beta in conjunctival scarring. Clin Sci (Lond). 2003;104(2)181–187.[Medline][Order article via Infotrieve]
  4. Tomasek JJ, Gabbiani G, Hinz B, Chaponnier C, Brown RA. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat Rev Mol Cell Biol. 2002;3(5)349–363.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  5. Desmouliere A, Geinoz A, Gabbiani F, Gabbiani G. Transforming growth factor-beta 1 induces alpha-smooth muscle actin expression in granulation tissue myofibroblasts and in quiescent and growing cultured fibroblasts. J Cell Biol. 1993;122(1)103–111.[Abstract/Free Full Text]
  6. Hinz B, Mastrangelo D, Iselin CE, Chaponnier C, Gabbiani G. Mechanical tension controls granulation tissue contractile activity and myofibroblast differentiation. Am J Pathol. 2001;159(3)1009–1020.[Abstract/Free Full Text]
  7. Katoh K, Kano Y, Amano M, et al. Rho-kinase–mediated contraction of isolated stress fibers. J Cell Biol. 2001;153(3)569–584.[Abstract/Free Full Text]
  8. Grinnell F. Fibroblasts, myofibroblasts, and wound contraction. J Cell Biol. 1994;124(4)401–404.[Free Full Text]
  9. Desmouliere A, Redard M, Darby I, Gabbiani G. Apoptosis mediates the decrease in cellularity during the transition between granulation tissue and scar. Am J Pathol. 1995;146(1)56–66.[Abstract]
  10. Ignotz RA, Massague J. Transforming growth factor-beta stimulates the expression of fibronectin and collagen and their incorporation into the extracellular matrix. J Biol Chem. 1986;261(9)4337–4345.[Abstract/Free Full Text]
  11. Zhang K, Rekhter MD, Gordon D, Phan SH. Myofibroblasts and their role in lung collagen gene expression during pulmonary fibrosis: a combined immunohistochemical and in situ hybridization study. Am J Pathol. 1994;145(1)114–125.[Abstract]
  12. Shah M, Foreman DM, Ferguson MW. Neutralisation of TGF-beta 1 and TGF-beta 2 or exogenous addition of TGF-beta 3 to cutaneous rat wounds reduces scarring. J Cell Sci. 1995;108(pt 3)985–1002.[Abstract]
  13. Cordeiro MF, Gay JA, Khaw PT. Human anti-transforming growth factor-beta2 antibody: a new glaucoma anti-scarring agent. Invest Ophthalmol Vis Sci. 1999;40(10)2225–2234.[Abstract/Free Full Text]
  14. Grisanti S, Szurman P, Warga M, et al. Decorin modulates wound healing in experimental glaucoma filtration surgery: a pilot study. Invest Ophthalmol Vis Sci. 2005;46(1)191–196.[Abstract/Free Full Text]
  15. Cordeiro MF, Mead A, Ali RR, et al. Novel antisense oligonucleotides targeting TGF-beta inhibit in vivo scarring and improve surgical outcome. Gene Ther. 2003;10(1)59–71.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  16. Meyer-ter-Vehn T, Gebhardt S, Sebald W, et al. p38 Inhibitors prevent TGF-β–induced myofibroblast transdifferentiation in human Tenon fibroblasts. Invest Ophthalmol Vis Sci. 2006;47(4)1500–1509.[Abstract/Free Full Text]
  17. Meyer-ter-Vehn T, Sieprath S, Katzenberger B, et al. Contractility as a prerequisite for TGF-β–induced myofibroblast transdifferentiation in human Tenon fibroblasts. Invest Ophthalmol Vis Sci. 2006;47(11)4895–4904.[Abstract/Free Full Text]
  18. LaRosa JC, He J, Vupputuri S. Effect of statins on risk of coronary disease: a meta-analysis of randomized controlled trials. JAMA. 1999;282(24)2340–2346.[Abstract/Free Full Text]
  19. Abramson J, Wright JM. Are lipid-lowering guidelines evidence-based?. Lancet. 2007;369(9557)168–169.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  20. Liao JK. Isoprenoids as mediators of the biological effects of statins. J Clin Invest. 2002;110(3)285–288.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  21. Greenwood J, Steinman L, Zamvil SS. Statin therapy and autoimmune disease: from protein prenylation to immunomodulation. Nat Rev Immunol. 2006;6(5)358–370.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  22. Kalinowski L, Dobrucki LW, Brovkovych V, Malinski T. Increased nitric oxide bioavailability in endothelial cells contributes to the pleiotropic effect of cerivastatin. Circulation. 2002;105(8)933–938.[Abstract/Free Full Text]
  23. Grinnell F, Ho CH, Lin YC, Skuta G. Differences in the regulation of fibroblast contraction of floating versus stressed collagen matrices. J Biol Chem. 1999;274(2)918–923.[Abstract/Free Full Text]
  24. Burridge K. Are stress fibres contractile?. Nature. 1981;294(5843)691–692.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  25. Hinz B, Gabbiani G. Mechanisms of force generation and transmission by myofibroblasts. Curr Opin Biotechnol. 2003;14(5)538–546.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  26. Garrett Q, Khaw PT, Blalock TD, et al. Involvement of CTGF in TGF-β1-stimulation of myofibroblast differentiation and collagen matrix contraction in the presence of mechanical stress. Invest Ophthalmol Vis Sci. 2004;45(4)1109–1116.[Abstract/Free Full Text]
  27. Esson DW, Neelakantan A, Iyer SA, et al. Expression of connective tissue growth factor after glaucoma filtration surgery in a rabbit model. Invest Ophthalmol Vis Sci. 2004;45(2)485–491.[Abstract/Free Full Text]
  28. Ridley AJ, Hall A. The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell. 1992;70(3)389–399.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  29. Liao JK, Laufs U. Pleiotropic effects of statins. Annu Rev Pharmacol Toxicol. 2005;45:89–118.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  30. Weitz-Schmidt G. Statins as anti-inflammatory agents. Trends Pharmacol Sci. 2002;23(10)482–486.[CrossRef][Medline][Order article via Infotrieve]
  31. Shiroshita-Takeshita A, Brundel BJ, Burstein B, et al. Effects of simvastatin on the development of the atrial fibrillation substrate in dogs with congestive heart failure. Cardiovasc Res. 2007;74(1)75–84.[Abstract/Free Full Text]
  32. Watts KL, Spiteri MA. Connective tissue growth factor expression and induction by transforming growth factor-beta is abrogated by simvastatin via a Rho signaling mechanism. Am J Physiol Lung Cell Mol Physiol. 2004;287(6)L1323–L1332.[Abstract/Free Full Text]
  33. Vieira JM, Jr, Mantovani E, Rodrigues LT, et al. Simvastatin attenuates renal inflammation, tubular transdifferentiation and interstitial fibrosis in rats with unilateral ureteral obstruction. Nephrol Dial Transplant. 2005;20(8)1582–1591.[Abstract/Free Full Text]
  34. Hinz B, Celetta G, Tomasek JJ, Gabbiani G, Chaponnier C. Alpha-smooth muscle actin expression upregulates fibroblast contractile activity. Mol Biol Cell. 2001;12(9)2730–2741.[Abstract/Free Full Text]
  35. Grinnell F, Zhu M, Carlson MA, Abrams JM. Release of mechanical tension triggers apoptosis of human fibroblasts in a model of regressing granulation tissue. Exp Cell Res. 1999;248(2)608–619.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  36. Kelynack KJ, Hewitson TD, Martic M, McTaggart S, Becker GJ. Lovastatin downregulates renal myofibroblast function in vitro. Nephron. 2002;91(4)701–707; discussion 708–709.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  37. Duncan MR, Frazier KS, Abramson S, et al. Connective tissue growth factor mediates transforming growth factor beta-induced collagen synthesis: down-regulation by cAMP. FASEB J. 1999;13(13)1774–1786.[Abstract/Free Full Text]
  38. Eberlein M, Heusinger-Ribeiro J, Goppelt-Struebe M. Rho-dependent inhibition of the induction of connective tissue growth factor (CTGF) by HMG CoA reductase inhibitors (statins). Br J Pharmacol. 2001;133(7)1172–1180.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  39. del Real G, Jimenez-Baranda S, Mira E, et al. Statins inhibit HIV-1 infection by down-regulating Rho activity. J Exp Med. 2004;200(4)541–547.[Abstract/Free Full Text]
  40. Porter KE, Turner NA, O'Regan DJ, Balmforth AJ, Ball SG. Simvastatin reduces human atrial myofibroblast proliferation independently of cholesterol lowering via inhibition of RhoA. Cardiovasc Res. 2004;61(4)745–755.[Abstract/Free Full Text]
  41. Song J, Deng PF, Stinnett SS, Epstein DL, Rao PV. Effects of cholesterol-lowering statins on the aqueous humor outflow pathway. Invest Ophthalmol Vis Sci. 2005;46(7)2424–2432.[Abstract/Free Full Text]
  42. Klein BE, Klein R, Lee KE, Grady LM. Statin use and incident nuclear cataract. JAMA. 2006;295(23)2752–2758.[Abstract/Free Full Text]
  43. Tan JS, Mitchell P, Rochtchina E, Wang JJ. Statin use and the long-term risk of incident cataract: the Blue Mountains Eye Study. Am J Ophthalmol. 2007;143(4)687–689.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
  44. Tan JS, Mitchell P, Rochtchina E, Wang JJ. Statins and the long-term risk of incident age-related macular degeneration: the Blue Mountains Eye Study. Am J Ophthalmol. 2007;143(4)685–687.[CrossRef][Web of Science][Medline][Order article via Infotrieve]



This article has been cited by other articles:


Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
J. A. Benton, H. B. Kern, L. A. Leinwand, P. D. Mariner, and K. S. Anseth
Statins Block Calcific Nodule Formation of Valvular Interstitial Cells by Inhibiting {alpha}-Smooth Muscle Actin Expression
Arterioscler Thromb Vasc Biol, November 1, 2009; 29(11): 1950 - 1957.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
iovs.07-1610v1
49/9/3955    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Meyer-ter-Vehn, T.
Right arrow Articles by Schlunck, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meyer-ter-Vehn, T.
Right arrow Articles by Schlunck, G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS