Originally published In Press as
doi:10.1167/iovs.07-1364 on June 6, 2008
(Investigative Ophthalmology and Visual Science. 2008;49:4203-4209.)
© 2008 by The Association for Research in Vision and Ophthalmology, Inc.
doi:10.1167/iovs.07-1364
Mitochondrial DNA Oxidative Damage Triggering Mitochondrial Dysfunction and Apoptosis in High Glucose-Induced HRECs
Lin Xie,
Xiaobo Zhu,
Yiqun Hu,
Tao Li,
Yi Gao,
Yu Shi, and
Shibo Tang
From the State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, China.
 |
Abstract
|
|---|
PURPOSE. Oxidative stress is linked to early apoptosis in diabetic retinopathy, and reactive oxygen species (ROS) play a critical role in that stress. Endogenous ROS generated from attacks of mitochondria on nearby mitochondrial DNA (mtDNA) could lead to constant ROS overproduction. The authors explored the role of mtDNA oxidative damage in high glucose-induced dysfunction in human retinal vascular endothelial cells (HRECs).
METHODS. mtDNA oxidative damage was examined by Southern blot analysis in HRECs treated with high glucose. The effect of mtDNA damage on the mRNA expression of respiratory chain subunits, change of mitochondrial membrane potential (
m), overproduction of ROS, and apoptosis were assessed in high glucose-treated HRECs by RT-PCR, flow cytometry, and confocal microscopy.
RESULTS. mtDNA oxidative damage increased rapidly after short-term (3-hour) exposure to high glucose (30 mM) and was severe after 48-hour exposure. Accordingly, the mRNA level of respiratory chain subunits NADPH-1 and CO1 encoded by mtDNA was significantly downregulated after 6-hour exposure to high glucose (P < 0.05) compared with levels encoded by nuclear DNA. Treatment with 12-, 24-, and 48-hour high glucose resulted in decreased membrane potential and overproduction of ROS in HRECs (P < 0.05); early apoptosis was observed with 24-hour (9.63% ± 1.26%) and 48-hour (12.30% ± 1.43%) treatment.
CONCLUSIONS. mtDNA oxidative damage seems to be the "trigger" for cell dysfunction in high glucose-treated HRECs by setting in motion the vicious circle of mtDNA damage leading to ROS overproduction and further mtDNA damage, which may explain in part early vascular damage in diabetic retinopathy.
Diabetic retinopathy, one of the most important microvascular complications in type 1 and type 2 diabetes, has been considered a major cause of visual impairment worldwide.1 2 Many biochemical mechanisms have been proposed to explain the structural and functional abnormalities associated with overexposure of the vascular tissues to hyperglycemia.3 4 5 Apoptosis of retinal capillary cells is an early event in the pathogenesis of diabetic retinopathy, and oxidative stress has been linked to accelerated apoptosis of retinal capillary cells.6 7 8 Recently, the role of oxidative stress in the development of diabetes has been emphasized, with reactive oxygen species (ROS) considered a key factor.9 10
The mitochondrial respiratory chain is the major endogenous source of intracellular ROS and is considered a causal link between elevated glucose and the major biochemical pathways. These pathways, including elevated polyol pathway activity, nonenzymatic glycation, and protein kinase C level, were postulated to be involved in the development of vascular complications.11 12 Earlier, vitamin E, a classic antioxidant, was found to decrease oxidative production without protecting against endothelial cell dysfunction in diabetic rats and cardiovascular patients.13 14 Antioxidant therapy with vitamin E or other antioxidants was suggested to be limited in scavenging already-formed oxidants and may be considered to treat the symptoms more than the cause in vascular oxidative stress. Therefore, superoxide dismutase or catalase mimetics, interrupting the overproduction of superoxide by the mitochondrial electron-transport chain, demonstrated more beneficial effect.15 16
How ROS is overproduced in hyperglycemia is unclear, and antioxidative therapy, scavenging formed oxidants and interrupting the overproduction of ROS, is probably passive. Among the biomacromolecules attacked by ROS, mitochondrial DNA (mtDNA) is nearest to the respiratory chain, the site of ROS production. Furthermore, mtDNA lacks a strong repair system compared with nuclear DNA.17 18 mtDNA, encoding most of the respiratory chain proteins, is largely attacked by ROS, which results in constant overproduction of ROS. In this process, oxidative damage of mtDNA seems to be a key point. From this scenario, we suggested that oxidative damage in mtDNA could explain ROS overproduction in hyperglycemia and ROS-mediated cellular damage "memory" after glucose normalization.19
Few studies have focused on the role of mtDNA oxidative damage of human retinal vascular endothelial cells (HRECs), the first to receive the hyperglycemia signal in the retina, in the development of diabetic retinopathy. We established HRECs induced by high glucose and determined by Southern blot analysis the lesions by 8-oxo-guanine (8-oxo-G), the sensitive marker of DNA oxidative damage, in mtDNA of HRECs. mtDNA oxidative damage found in high glucose-treated HRECs could trigger mitochondrial dysfunction and apoptosis. This result furthers the understanding of the mechanism of vascular dysfunction in diabetic retinopathy and may offer a new target for therapy of diabetic vascular complications.
 |
Methods
|
|---|
HREC Culture and Treatment
Cultured HRECs from eyes of 10 donors were obtained from the Zhongshan Ophthalmic Center Eye Bank. The donors, whose mean age was 32.3 years, had been otherwise healthy victims of accidents. The procedures for harvesting retinas were previously described.20 Briefly, to avoid significant pigment epithelium contamination, the retinas were harvested carefully, placed in Hanks balanced salt solution, and washed. After they were minced gently, the retinal pieces were digested in 2% trypsin for 20 minutes at room temperature, collected by centrifugation at 1200 rpm, and resuspended in 0.1% collagenase for 20 minutes at 37°C. The homogenate underwent centrifugation (1000 rpm,10 minutes), and the pellet was resuspended in human endothelial-serum free medium (HE-SFM; Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum, 5 ng/mL recombinant human β-endothelial cell growth factor (β-ECGF; R&D Systems, Minneapolis, MN), and 1% insulin-transferrin-selenium.
Cells were cultured in fibronectin-coated flasks and incubated at 37°C in a humidified atmosphere containing 5% CO2. Cultured cells were characterized for endothelial homogeneity by testing for immunoreactivity to factor VIII antigen on light microscopy. To avoid age-dependent cellular modification, only cells at passages 2 and 3 were used.
HRECs were seeded in a Petri dish and then in a logarithmic phase were exposed to HE-SFM with 30 mM glucose for 1, 3, 6, 12, 24, and 48 hours; control cells were cultured in HE-SFM with 5 mM glucose. (We chose the 48-hour untreated HRECs as control because there was no significant change in untreated age-matched cells in our preliminary experiment.)
Southern Blot Analysis of mtDNA Oxidative Damage
At the indicated times, the cells of two 60-mm dishes were digested and harvested by centrifugation; cell pellets were kept in –80°C for analysis. DNA was extracted (DNeasy Blood & Tissue Kit; Qiagen, Hilden, Germany), and 10 µg purified DNA was digested with 1 µL BamHI (NEB, Hitchin, UK) overnight at 37°C. After restriction, DNA was purified by use of phenol-chloroform and dissolved in distilled water. Precise DNA concentrations were measured by use of a biophotometer. Restricted DNA (1.5 µg) was digested with 0.75 µL formamidopyrimidine DNA glycosylase (Fpg) protein (NEB). Reaction was stopped by heat at 60°C for 10 minutes. The mixture, including 1 µg DNA, was separated in a 0.8% denaturing alkaline agarose gel and transferred to a nylon membrane. The content of 8-oxo-G lesions was determined by use of a labeling and detection kit (DIG High Prime DNA Labeling and Detection Starter kit; Roche, Mannheim, Germany). The membrane was hybridized with a DIG-labeled probe overnight at 60°C. The probe for mtDNA was generated by PCR, with the human total DNA sequence used as a template. Primer sequences for the mitochondrial probe were forward, 5'TAGGGTTTACGACCTCGAATGTT, and reverse, 5'GTTCATAGTAGAAGAGCGATG. The 592-bp PCR product was hybridized with a restriction fragment of human mtDNA digested with BamHI. After hybridization, the membrane was washed and developed with DIG. Resultant band images were scanned by use of a gel imaging system (Viber Lourmat, Marne la Valee, France) and were analyzed with image analysis software (Gel-Pro Analyzer; Media Cybernetics, Bethesda, MD). Results of four experiments were pooled to calculate changes in equilibrium lesion density with the Poisson equation (s = –ln BIH/BIC, where s is the number of enzyme incisions, BIH is the band intensity in high glucose-treated HRECs, and BIC is the band intensity in controls).21
Semiquantitative PCR
Total RNA was isolated by use of an RNA purification system (PureLink Microto-Midi Total RNA Purification System; Invitrogen, Carlsbad, CA). RNA (1 µg) was reverse transcribed by first-strand synthesis (SuperScript III First-Strand Synthesis System for RT-PCR; Invitrogen). For PCR amplification, 1 µL cDNA was denatured for 5 minutes at 94°C, then for 26 cycles for CO1 and NADPH-1 and 28 cycles for ATPsynβ. Each cycle included 1-minute denaturation at 94°C, 40-second primer annealing at 50°C for CO1, 60°C for NADPH-1, and 58.2°C for ATPsynβ, then 1-minute polymerization at 72°C. Primer sequences were as follows: NADPH-1 forward, 5'-GGCCCCAACGTGGTAGGC; NADPH-1 reverse, 5'-GTCGTAGCGGAATCGGGG; CO1 forward, 5'-TCCATAACGCTCCTCATACT; CO1 reverse: 5'-GTGGTAAAAGGCTCAGAAAA; ATPsynβ forward, 5'-TCTCCTTCGCCAAAAGCAGG; ATPsynβ reverse, 5'-TGTTTGGTTTTGATGGGACC; β-actin(Actb) forward, 5'-CTACAATGAGCTGCGTGTGG; and β-actin reverse, 5'-CGGTGAGGATCTTCATGAGG. RT-PCR products were 745, 233, 335, and 314 bp, respectively.
Flow Cytometry for Measurement of 
m
To measure the 
m of HRECs challenged by high glucose, we used a fluorescent probe (5,5',6,6'-tetrachloro-1,1',3,3'-tetraethylbenzimidazole carbocyanide iodide; JC-1; Molecular Probes, Eugene, OR) as described.22 Briefly, HRECs (5 x 105) were collected by trypsinization, washed in PBS, and incubated with 1.0 µg/mL fluorescent probe (JC-1; Molecular Probes) for 15 minutes at 37°C. Cells were pelleted at 800 rpm for 5 minutes, washed in PBS, and analyzed immediately by flow cytometry, by use of a flow cytometer (BD FACS Aria; Becton Dickinson, Mountain View, CA) and BD software (FACSDiVa; Becton Dickinson). Photomultiplier settings were adjusted to detect green fluorescence (
em = 525 nm) of fluorescent probe (JC-1; Molecular Probes) monomer on filter 1 and red fluorescence (
em = 590 nm) of fluorescent probe (JC-1; Molecular Probes) aggregates on filter 2. In each experiment, 20,000 events were analyzed. The ratio of red/green (aggregate/monomer) fluorescence intensity values was used to assess 
m.
ROS Assay
Cultured cells underwent double-labeling with 20,70-dichlorodihydrofluorescein diacetate (H2DCFDA; Molecular Probes) to detect ROS production and mitochondrion-specific dye (MitoFLuor Red 589; MFL; Molecular Probes) to visualize mitochondria. MFL accumulates in mitochondria regardless of mitochondrial membrane potential and has a long emission wavelength (622 nm) that is well resolved from the 525-nm emission wavelength of green fluorescein analogues such as H2DCFDA. HRECs were rinsed with PBS at different times. After H2DCFDA and MFL were added to nonphenol red culture media with final concentrations of 2 mM and 500 nM, respectively, cells were incubated at 37°C for 45 minutes, then washed twice with fresh prewarmed medium and viewed under a laser scanning confocal microscope (LSM 510; Zeiss, Oberkochen, Germany). The green fluorescence of H2DCFDA was excited at 488 nm, and that of MFL was excited at 588 nm. Mean fluorescence intensity per square millimeter cell area was calculated by use of the Zeiss software.
Flow Cytometry for Measurement of Apoptosis
Apoptosis was assessed by use of an annexin V/propidium iodide (PI) kit according to the manufacturers instructions (Bender Med Systems, Vienna, Austria). HRECs (5 x 105) were washed twice with PBS and suspended in 100 µL 1x binding buffer. Annexin V (5 µL) and 10 µL PI were added to the cell suspension, vortexed, and incubated for 15 minutes in the dark. Finally, 400 µL of 1x binding buffer was added, and samples were evaluated by flow cytometry.
 |
Results
|
|---|
Increased mtDNA Oxidative Damage in HRECs Treated with High Glucose
Total DNA from high glucose-treated HRECs and controls was treated with saturating concentrations of Fpg to determine the level of endogenous mtDNA lesion damage by 8-oxo-G, a sensitive marker of DNA oxidative damage (Fig. 1a) . Treatment with high glucose (30 mM) beginning at 3 hours showed increased mtDNA damage in HRECs treated with high glucose (Fig. 1b) .

View larger version (11K):
[in this window]
[in a new window]
|
FIGURE 1. Representative quantitative Southern blot analysis of mtDNA oxidative damage in HRECs. (a) Hybridization intensity of mtDNA from HRECs treated with normal (5 mM; control, C) and high (30 mM) levels of glucose for the indicated times. (b) Calculated changes in equilibrium lesion density by 8-oxo-G. Results are mean ± SD of four experiments. *P < 0.05.
|
|
Downregulation of Respiratory Chain Subunits NADPH-1 and CO1 but Not ATPsynβ with Hyperglycemia
To understand the mechanism of high glucose-induced cell dysfunction, we examined high glucose-induced alteration in the mRNA level of several respiratory chain subunits. The mRNA level of NADPH-1 and CO1, encoded by mtDNA, was downregulated in a time-dependent manner, beginning at 6 hours (1.04 ± 0.09) and 12 hours (0.54 ± 0.07; both P < 0.05) of treatment; at 48 hours, both subunits showed significantly decreased expression of high-glucose exposure (Fig. 2a) . However, ATPsynβ, encoded by nuclear DNA, showed no significant change in expression (Fig. 2b) .

View larger version (40K):
[in this window]
[in a new window]
|
FIGURE 2. (a) Lanes 9 to 15: RT-PCR analysis of mRNA of NADPH-1, CO1, and ATPsynβ in controls and high glucose-treated HRECs at various times. Lanes 1 to 7: β-actin. Lane 8: 100-bp ladder. (b) Downregulation of NADPH-1 and CO1 began at 6 and 12 hours, respectively. Normalization was β-actin (Actb) (*P < 0.05). Both subunits showed significant decreases with 48-hour exposure to high glucose (30 mM). Results are representative of experiments repeated four times.
|
|
Disturbance of 
m in HRECs Treated with High Glucose
To determine the involvement of the mitochondrial-mediated pathway in high glucose-induced cell dysfunction, we measured 
m by flow cytometry. High-glucose treatment of HRECs resulted in rapid deterioration in membrane potential in a time-dependent manner (Fig. 3) . A significant decrease in the ratio of red to green fluorescence began at 12 hours (18.65 ± 3.82) and continued at 24 hours (8.86 ± 3.09) and 48 hours (5.44 ± 2.30; all P < 0.05) after high-glucose treatment.
Overproduction of ROS in High Glucose-Treated HRECs
Confocal microscopy was used to localize the high glucose-induced increase of ROS production in mitochondria of HRECs. MFL and H2DCFDA fluorescence to visualize mitochondria location and ROS production, respectively, showed high colocalization with longer exposure to high-glucose treatment, indicating that mitochondria are the major source of ROS production on exposure (Fig. 4) . H2DCFDA fluorescence intensity per square millimeter cell area increased over time beginning at 12 hours (9.90 ± 1.68; P < 0.05).

View larger version (59K):
[in this window]
[in a new window]
|
FIGURE 4. (a) Colocalization of high glucose-induced ROS production in mitochondria by confocal microscopy. HRECs were incubated in high-glucose (30 mM) medium for the indicated times. Red fluorescence is MFL, for mitochondria; green fluorescence is H2DCFDA, for ROS; yellow fluorescence shows regions in which ROS and mitochondria colocalized. (b) Quantitative analysis of the H2DCFDA fluorescence intensity per square millimeter cell area in HRECs treated for the indicated times. Values represent mean ± SD of four independent experiments. *P < 0.05.
|
|
Apoptosis in HRECs Treated with High Glucose
Apoptosis in HRECs was triggered beginning at 24-hour high-glucose treatment (Fig. 5) . The proportion of early apoptosis, represented by AV+PI– cells, was significantly increased in a time-dependent manner, with 9.63% ± 1.26% at 24 hours and 12.30% ± 1.43% at 48 hours compared with controls (1.35% ± 0.68%). The proportion of late apoptosis, represented by AV+PI+ cells, was also significantly increased with 16.4% ± 1.24% at 24 hours and 19.73% ± 1.43% at 48 hours compared with controls (3.65% ± 0.92%).

View larger version (26K):
[in this window]
[in a new window]
|
FIGURE 5. HRECs were treated with normal (5 mM; control) and high (30 mM) levels of glucose for the indicated times and then were stained for flow cytometry analysis. (a) Early apoptotic populations are in the lower-right quadrant; late apoptotic cells are in the upper-right quadrant. (b) Proportions of early and late apoptosis in HRECs on treatment with high glucose for the indicated times. Values represent mean ± SD of results of four independent experiments. *P < 0.05.
|
|
 |
Discussion
|
|---|
Apoptosis and the expression of adhesion molecules in retinal vessels leading to leakage and occlusion of capillaries are two major early pathologic changes in diabetic retinopathy. Oxidative stress, involved in mitochondrial dysfunction and apoptosis in early damage of diabetic vascular complications, was demonstrated by recent studies.7 9 The overproduction of ROS seems to be the first and key event in the activation of other pathways involved in the pathogenesis of diabetic complications, including elevated polyol pathway activity, nonenzymatic glycation, and protein kinase C level.3 23 24 25 26 In agreement with other reports of nonendothelial cells exposed to high glucose,27 28 our results with HRECs also showed the overproduction of ROS and apoptosis, with high-glucose treatment associated with very early mtDNA damage 3 hours after treatment.
Some research has indicated that ROS, accompanied by increased NO generation, favors the formation of the strong oxidant peroxynitrite.29 Peroxynitrite, a potent initiator of DNA single-strand breakage, activates the nuclear enzyme poly(ADP-ribose) polymerase, which could lead to cell death.30 In addition, peroxynitrite by itself can increase the expression of adhesion molecules.31 Thus, apoptosis and increased expression of adhesion molecules are both closely related to ROS. With the pathways by which ROS leads to cell dysfunction elucidated, the mechanism of ROS overproduction in hyperglycemia needs further research.
Given the process of mtDNA damage leading to ROS overproduction and further mtDNA damage, mtDNA oxidative damage may be the early damage event in diabetic retinopathy. We found that mtDNA oxidative damage, as seen with 8-oxo-G lesion analysis, appeared very early in HRECs, 3 hours after exposure to high glucose, much earlier than the overproduction of ROS. Recently, the marked alteration of various protein subunits related to oxidative stress was observed on short-term, high-glucose treatment of nonendothelial cells or animals; the shortest effect time was 1 hour.32 33 34 Thus, the original mtDNA oxidative damage was not caused by the overproduced ROS in our high glucose-treated HRECs. mtDNA oxidative damage could have occurred quickly at first, contributing to the overproduction of ROS, and the overproduced ROS could have attacked mtDNA in return, which may explain why the Southern hybridization intensity with analysis of mtDNA damage was weak at 48 hours after exposure to high glucose.
A sensitive biomarker of oxidative DNA damage,35 8-oxo-G was quantitated with ELISA or quantitative PCR in other studies.36 37 The level of damage with 8-oxo-G lesions was higher and more extensive in mtDNA than in nuclear DNA in multiple tissues.18 Moreover, almost all mtDNA encodes respiratory chain subunits. Rapid mtDNA oxidative damage with high glucose might have affected transcription and translation of respiratory chain subunits, so we examined high glucose-induced alteration in the expression of several subunits. Compared with the expression of ATPsynβ, encoded by nuclear DNA, that of NADPH-1 and CO1, encoded by mtDNA, was downregulated. The subunits of complex I (NADPH-1) and complex IV (CO1) in the mitochondrial respiratory chain are the sites of ROS production and are involved in ROS regulation. Thus, oxidative mtDNA damage, changing the transcription of respiratory chain subunits, led to the overproduction of ROS in high glucose-treated HRECs.
A highly sensitive indicator of the energetic state of cells, 
m was affected in various oxidative stress models.37 38 39 The depolarization of mitochondria, followed by a permeable transition pore opening and outflow of cytochrome c, predicts the activation of early apoptosis through the mitochondrial pathway.40 41 42 We also observed a decrease in membrane potential at 12 hours and apoptosis at 24 hours after exposure to high glucose. mtDNA oxidative damage may promote the mitochondrial pathway of apoptosis under high glucose. Moreover, repairing mtDNA oxidative damage to prevent apoptosis has been confirmed in other models of oxidative stress.43
The present study demonstrates that mtDNA oxidative damage acts as the trigger in vascular damage of diabetic retinopathy by setting in motion the vicious circle of mtDNA oxidative damage, leading to the overproduction of ROS and to further mtDNA damage. Our results also help in understanding the hyperglycemia "memory" found in in vivo or in vitro studies19 44 : once mtDNA oxidative damage occurs, though hyperglycemia is normalized, the cycle is switched on, continuously overproducing ROS involved in various downstream impairment pathways. This trigger may be the key to understanding the pathogenesis and treatment of diabetic retinopathy. However, elucidating the reason for this rapid mtDNA oxidative damage after short-term exposure to high glucose in HRECs requires further study.
 |
Acknowledgements
|
|---|
The authors thank the Zhongshan Ophthalmic Center Eye Bank for its support.
 |
Footnotes
|
|---|
Supported by the National Nature Science Foundation in China Grants 30471849 and 30672278.
Submitted for publication October 25, 2007; revised April 10 and May 19, 2008; accepted July 21, 2008.
Disclosure: L. Xie, None; X. Zhu, None; Y. Hu, None; T. Li, None; Y. Gao, None; Y. Shi, None; S. Tang, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: Shibo Tang, State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou 510060, China; tang0485{at}yahoo.com.cn.
 |
References
|
|---|
- Frank RN. Diabetic retinopathy. N Engl J Med. 2004;350(1)48–58.[Free Full Text]
- Aylward GW. Progressive changes in diabetics and their management. Eye. 2005;19(10)1115–1118.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Kowluru RA. Effect of advanced glycation end products on accelerated apoptosis of retinal capillary cells under in vitro conditions. Life Sci. 2005;76(9)1051–1060.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Yamagishi S, Nakamura K, Ueda S, Kato S, Imaizumi T. Pigment epithelium-derived factor (PEDF) blocks angiotensin II signaling in endothelial cells via suppression of NADPH oxidase: a novel anti-oxidative mechanism of PEDF. Cell Tissue Res. 2005;320(3)437–445.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Xia P, Inoguchi T, Kern TS, Engerman RL, Oates PJ, King GL. Characterization of the mechanism for the chronic activation of diacylglycerol-protein kinase C pathway in diabetes and hypergalactosemia. Diabetes. 1994;43(9)1122–1129.[Abstract]
- Kowluru RA, Odenbach S. Effect of long-term administration of alpha-lipoic acid on retinal capillary cell death and the development of retinopathy in diabetic rats. Diabetes. 2004;53(12)3233–3238.[Abstract/Free Full Text]
- Cui Y, Xu X, Bi H, et al. Expression modification of uncoupling proteins and MnSOD in retinal endothelial cells and pericytes induced by high glucose: the role of reactive oxygen species in diabetic retinopathy. Exp Eye Res. 2006;83(4)807–816.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Sugiyama T, Kobayashi M, Kawamura H, Li Q, Puro DG. Enhancement of P2X(7)-induced pore formation and apoptosis: an early effect of diabetes on the retinal microvasculature. Invest Ophthalmol Vis Sci. 2004;45(3)1026–1032.[Abstract/Free Full Text]
- Zurova-Nedelcevova J, Navarova J, Drabikova K, et al. Participation of reactive oxygen species in diabetes-induced endothelial dysfunction. Neuro Endocrinol Lett. 2006;27(suppl 2)168–171.[Medline][Order article via Infotrieve]
- Ebrahimian TG, Heymes C, You D, et al. NADPH oxidase-derived overproduction of reactive oxygen species impairs postischemic neovascularization in mice with type 1 diabetes. Am J Pathol. 2006;169(2)719–728.[Abstract/Free Full Text]
- Nishikawa T, Edelstein D, Du XL, et al. Normalizing mitochondrial superoxide production blocks three pathways of hyperglycaemic damage. Nature. 2000;404(6779)787–790.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Du XL, Edelstein D, Rossetti L, et al. Hyperglycemia-induced mitochondrial superoxide overproduction activates the hexosamine pathway and induces plasminogen activator inhibitor-1 expression by increasing Sp1 glycosylation. Proc Natl Acad Sci U S A. 2000;97(22)12222–12226.[Abstract/Free Full Text]
- Palmer AM, Thomas CR, Gopaul N, et al. Dietary antioxidant supplementation reduces lipid peroxidation but impairs vascular function in small mesenteric arteries of the streptozotocin-diabetic rat. Diabetologia. 1998;41(2)148–156.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Marchioli R, Schweiger C, Levantesi G, Gavazzi L, Valagussa F. Antioxidant vitamins and prevention of cardiovascular disease: epidemiological and clinical trial data. Lipids. 2001;36:S53–S63.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Nassar T, Kadery B, Lotan C, Da'as N, Kleinman Y, Haj-Yehia A. Effects of the superoxide dismutase mimetic compound tempol on endothelial dysfunction in streptozotocin-induced diabetic rats. Eur J Pharmacol. 2002;436(1–2)111–118.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Coppey LJ, Gellett JS, Davidson EP, et al. Effect of M40403 treatment of diabetic rats on endoneurial blood flow, motor nerve conduction velocity and vascular function of epineurial arterioles of the sciatic nerve. Br J Pharmacol. 2001;134(1)21–29.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Dizdaroglu M. Chemical determination of free radical-induced damage to DNA. Free Radic Biol Med. 1991;10(3–4)225–242.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Yakes FM, Van Houten B. Mitochondrial DNA damage is more extensive and persists longer than nuclear DNA damage in human cells following oxidative stress. Proc Natl Acad Sci. 1997;94(2)514–519.[Abstract/Free Full Text]
- Ihnat MA, Thorpe JE, Kamat CD, et al. Reactive oxygen species mediate a cellular "memory" of high glucose stress signaling. Diabetologia. 2007;50(7)1523–1531.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Capetandes A, Gerritsen ME. Simplified methods for consistent and selective culture of bovine retinal endothelial cells and pericytes. Invest Ophthalmol Vis Sci. 1990;31(9)1738–1744.[Abstract/Free Full Text]
- Anson RM, Mason PA, Bohr VA. Gene-specific and mitochondrial repair of oxidative DNA damage. Methods Mol Biol. 2006;314:155–181.[Medline][Order article via Infotrieve]
- Salvioli S, Ardizzoni A, Franceschi C, Cossarizza A. JC-1, but not DiOC6(3) or rhodamine 123, is a reliable fluorescent probe to assess delta psi changes in intact cells: implications for studies on mitochondrial functionality during apoptosis. FEBS Lett. 1997;411(1)77–82.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Amano S, Yamagishi S, Kato N, et al. Sorbitol dehydrogenase overexpression potentiates glucose toxicity to cultured retinal pericytes. Biochem Biophys Res Commun. 2002;299(2)183–188.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Wautier MP, Chappey O, Corda S, Stern DM, Schmidt AM, Wautier JL. Activation of NADPH oxidase by AGE links oxidant stress to altered gene expression via RAGE. Am J Physiol Endocrinol Metab. 2001;280(5)E685–E694.[Abstract/Free Full Text]
- Zhang M, Kho AL, Anilkumar N, et al. Glycated proteins stimulate reactive oxygen species production in cardiac myocytes: involvement of Nox2 (gp91phox)-containing NADPH oxidase. Circulation. 2006;113(9)1235–1243.[Abstract/Free Full Text]
- Inoguchi T, Li P, Umeda F, et al. High glucose level and free fatty acid stimulate reactive oxygen species production through protein kinase C-dependent activation of NAD(P)H oxidase in cultured vascular cells. Diabetes. 2000;49(11)1939–1945.[Abstract]
- Quan Y, Du J, Wang X. High glucose stimulates GRO secretion from rat microglia via ROS, PKC, and NF-
B pathways. J Neurosci Res. 2007;85(14)3150–3159.[CrossRef][Web of Science][Medline][Order article via Infotrieve] - Sharifi AM, Mousavi SH, Farhadi M, Larijani B. Study of high glucose-induced apoptosis in PC12 cells: role of bax protein. J Pharmacol Sci. 2007;104(3)258–262.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Yoshie Y, Ohshima H. Nitric oxide synergistically enhances DNA strand breakage induced by polyhydroxyaromatic compounds, but inhibits that induced by the Fenton reaction. Arch Biochem Biophys. 1997;342(1)13–21.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Szabo C, Ohshima H. DNA damage induced by peroxynitrite: subsequent biological effects. Nitric Oxide. 1997;1(5)373–385.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Zou MH, Shi C, Cohen RA. High glucose via peroxynitrite causes tyrosine nitration and inactivation of prostacyclin synthase that is associated with thromboxane/prostaglandin H(2) receptor-mediated apoptosis and adhesion molecule expression in cultured human aortic endothelial cells. Diabetes. 2002;51(1)198–203.[Abstract/Free Full Text]
- Yan HD, Li XZ, Xie JM, Li M. Effects of advanced glycation end products on renal fibrosis and oxidative stress in cultured NRK-49F cells. Chin Med J. 2007;120(9)787–793.[Web of Science][Medline][Order article via Infotrieve]
- Greenman IC, Gomez E, Moore CE, Herbert TP. Distinct glucose-dependent stress responses revealed by translational profiling in pancreatic beta-cells. J Endocrinol. 2007;192(1)179–187.[Abstract/Free Full Text]
- Piga R, Naito Y, Kokura S, Handa O, Yoshikawa T. Short-term high glucose exposure induces monocyte-endothelial cells adhesion and transmigration by increasing VCAM-1 and MCP-1 expression in human aortic endothelial cells. Atherosclerosis. 2007;193(2)328–334.[Medline][Order article via Infotrieve]
- Pilger A, Rudiger HW. 8-Hydroxy-2'-deoxyguanosine as a marker of oxidative DNA damage related to occupational and environmental exposures. Int Arch Occup Environ Health. 2006;80(1)1–15.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Boonla C, Wunsuwan R, Tungsanga K, Tosukhowong P. Urinary 8-hydroxydeoxyguanosine is elevated in patients with nephrolithiasis. Urol Res. 2007;35(4)185–191.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Sen T, Sen N, Jana S, Khan FH, Chatterjee U, Chakrabarti S. Depolarization and cardiolipin depletion in aged rat brain mitochondria: relationship with oxidative stress and electron transport chain activity. Neurochem Int. 2007;50(5)719–725.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Bernstein BW, Chen H, Boyle JA, Bamburg JR. Formation of actin-ADF/cofilin rods transiently retards decline of mitochondrial potential and ATP in stressed neurons. Am J Physiol Cell Physiol. 2006;291(5)C828–C839.[Abstract/Free Full Text]
- Szilágyi G, Simon L, Koska P, Telek G, Nagy Z. Visualization of mitochondrial membrane potential and reactive oxygen species via double staining. Neurosci Lett. 2006;399(3)206–209.[CrossRef][Web of Science][Medline][Order article via Infotrieve]
- Madesh M, Hajnoczky G. VDAC-dependent permeabilization of the outer mitochondrial membrane by superoxide induces rapid and massive cytochrome c release. J Cell Biol. 2001;155(6)1003–1015.[Abstract/Free Full Text]
- Jambrina E, Alonso R, Alcalde M, et al. Calcium influx through receptor-operated channel induces mitochondria-triggered paraptotic cell death. J Biol Chem. 2003;278(16)14134–14145.[Abstract/Free Full Text]
- Akao M, O'Rourke B, Teshima Y, Seharaseyon J, Marban E. Mechanistically distinct steps in the mitochondrial death pathway triggered by oxidative stress in cardiac myocytes. Circ Res. 2003;92(2)186–194.[Abstract/Free Full Text]
- Links Dobson AW, Grishko V, LeDoux SP, Kelley MR, Wilson GL, Gillespie MN. Enhanced mtDNA repair capacity protects pulmonary artery endothelial cells from oxidant-mediated death. Am J Physiol Lung Cell Mol Physiol. 2002;283(1)L205–L210.[Abstract/Free Full Text]
- Roy S, Sala R, Cagliero E, Lorenzi M. Overexpression of fibronectin induced by diabetes or high glucose: phenomenon with a memory. Proc Natl Acad Sci U S A. 1990;87(1)404–408.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
S. Saraswathy and N. A. Rao
Mitochondrial Proteomics in Experimental Autoimmune Uveitis Oxidative Stress
Invest. Ophthalmol. Vis. Sci.,
December 1, 2009;
50(12):
5559 - 5566.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Gao and G. E. Mann
Vascular NAD(P)H oxidase activation in diabetes: a double-edged sword in redox signalling
Cardiovasc Res,
April 1, 2009;
82(1):
9 - 20.
[Abstract]
[Full Text]
[PDF]
|
 |
|